BBa_K1620003 1 IbpB small heat shock protein IbpB 2015-09-02T11:00:00Z 2015-09-13T03:54:01Z This part was designed from gene IbpB of E. coli K12 MG1655 genome, and synthesized by IDT. PCR amplifications were carried out using primers showed bellow and the 3A assembly method was made. PCR primers: Fwd: 5' - GAA TTC GCG GCC GCT TCT AGA GAT GAC TAT GCG TAA CTT CGA - 3' Rev: 5' - TAC TAG TAG CGG CCG CTG CAG TTA GCT ATT TAA CGC GGG AC - 3' Together with IbpB, to stabilize and protect them from irreversible denaturation and extensive proteolysis during heat shock and oxidative stress. Aggregated proteins bound to the IbpAB complex are more efficiently refolded and reactivated by the ATP-dependent chaperone systems ClpB and DnaK/DnaJ/GrpE. Its activity is ATP-independent. http://www.uniprot.org/uniprot/P0C054>. The IbpB is a small heat shock protein. It is expressed under stress conditions which associates with aggregated proteins. Together with IbpA, to stabilize and protect them from irreversible denaturation and extensive proteolysis during heat shock and oxidative stress. Aggregated proteins bound to the IbpAB complex are more efficiently refolded and reactivated by the ATP-dependent chaperone systems ClpB and DnaK/DnaJ/GrpE. Its activity is ATP-independent. It is extensively documented in the following link: <http://www.uniprot.org/uniprot/P0C058>. In our project, we have figured out to construct a protein solubilization device for high rate expressed proteins. false false _2037_ 23597 23597 9 false This part was made using original codon frequencies of E. coli. false Celio Dias Santos Jr annotation2443230 1 Rev range2443230 1 416 435 annotation2443229 1 Fwd range2443229 1 1 20 annotation2443228 1 IbpB range2443228 1 1 435 BBa_K1620003_sequence 1 atgactatgcgtaacttcgatttatccccactgatgcgtcaatggatcggttttgacaaactggccaacgcactgcaaaacgccggtgaaagccagagcttcccgccgtacaacattgagaaaagcgacgataaccactaccgcattacccttgcgctggcaggtttccgtcaggaagatttagagattcaactggaaggtacgcgcctgagcgtaaaaggcacgccggagcagccaaaagaagagaaaaaatggctgcatcaagggcttatgaatcagccatttagcctgagctttacgctggctgaaaatatggaagtctctggcgcaaccttcgtaaacggtttactgcatattgatttaattcgtaatgagcctgaacccatcgcagcgcagcgtatcgctatcagcgaacgtcccgcgttaaatagctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z