BBa_K163005 1 BBa_K163005 Mefp Decapeptide Optimized for E. coli 2008-10-10T11:00:00Z 2015-05-08T01:10:55Z Mefp-1 Decapeptide sequence found in fp-151, codon-optimized for E. coli. false false _261_ 0 2746 9 Not in stock false In creating Mefp-151, we include six of these before Mefp-5 and then six after. false Daniel M. Choi BBa_K163005_sequence 1 catgagagatctgcgaaaccgtcttacccgccgacctacaaagtcgacctagag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z