BBa_K1633003 1 BBa_K1633003 MOR siRNA-1 (siRNA for mouse Mu opioid receptor) 2015-09-12T11:00:00Z 2015-09-18T08:34:21Z We designed the MOR siRNA-1 sequence and ordered the sequence from a DNA synthesis company. This part is a short hairpin RNA (shRNA) sequence. When this shRNA sequence is cut by restriction enzyme and then integrated into pcDNA 6.2 vector, this shRNA can play a RNAi function in mammalian cell lines such as HEK293 cell. When the shRNA vector of MOR is transfected into HEK293 cells, the shRNA hairpin structure is cleaved by Dicer into siRNA of MOR and loaded into the RISC. The siRNA-RISC complex targets at Mus musculus MOR mRNA under the guide of siRNA sequence and cleave the MOR mRNA. false false _2050_ 16730 16730 9 false We designed specific MOR siRNAs based on a free software accessible online. This tool can find the best siRNA sequences on target gene MOR to insure the maximum gene-specificity and silencing efficacy. This tool also designs the pair of oligonucleotides needed to generate short hairpin RNAs (shRNAs) in the plasmid. false Chen Xi, Zhou Yu, Jiang Waner, Zhang Peng, Tian Chenfei BBa_K1633003_sequence 1 ttaacactctgaaagggcagcgttttggccactgactgacgctgccctcagagtgttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z