BBa_K1639005 1 BBa_K1639005 H-NS(T108I) 2015-09-11T11:00:00Z 2015-09-18T07:26:04Z Escherichia Coli K-12, sequence taken through Genbank: http://www.ncbi.nlm.nih.gov/gene/945829 global DNA-binding transcriptional dual regulator H-NS mutant form. false false _2056_ 20835 20835 9 false This part contains an additional BamHI restriction site at beginning of H-NS(T108I) sequence and a XhoI restriction site at the end. This is a mutant form of H-NS protein which has Isoleucine instead of Threonin at 108. position. false Mustafa Yılmaz annotation2452960 1 ATG Start Codon range2452960 1 9 11 annotation2452962 1 Stop Codon range2452962 1 420 425 annotation2452959 1 H-NS(T108I) range2452959 1 9 422 annotation2452961 1 T108I range2452961 1 330 332 BBa_K1639005_sequence 1 gggatccgatgagcgaagcacttaaaattctgaacaacatccgtactcttcgtgcgcaggcaagagaatgtacacttgaaacgctggaagaaatgctggaaaaattagaagttgttgttaacgaacgtcgcgaagaagaaagcgcggctgctgctgaagttgaagagcgcactcgtaaactgcaacaatatcgcgaaatgctgatcgctgacggtattgacccgaacgaactgctgaatagccttgctgccgttaaatctggcaccaaagctaaacgtgctcagcgtccggcaaaatatagctacgttgacgaaaacggcgaaactaaaatttggactggccaaggccgtactccagctgtaatcaaaaaagcaatggatgagcaaggtaaatccctcgacgatttcctgatcaagcaataataactcgagt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z