BBa_K1639009 1 BBa_K1639009 LacI regulated DsRed with miR 26a and miR 375 binding sites 2015-09-14T11:00:00Z 2015-09-16T11:20:08Z This part is combination of lac operators derived from E.coli and DsRed protein originally found in Discosoma sp. and also this part contains miR binding sites at 3' end. bir onceki partimizdaki LacI bunu baskilaycaktir.... DsRed ise GFP nin bir derivative halidir. kirmizi floresan proteinidir. mustafa buraya resimleri eklemeyi bilmiyorum halledelim. false false _2056_ 24778 24789 9 false miRNA binding sites make it possible to supress its expression by increasing miR levels. But in gastric cancer cells the levels of miR26a and miR 375 are low unlikely of normal epithelial cells. As a result expression of this protein supressed in normal cells but not in cancerous cells. false Nurgeldi Bazarov annotation2457710 1 miR-375 binding site range2457710 1 843 864 annotation2457709 1 miR-26a binding site range2457709 1 802 823 annotation2457705 1 Kozak range2457705 1 109 114 annotation2457707 1 ATG range2457707 1 115 117 annotation2457704 1 lacO (symmetric) range2457704 1 78 97 annotation2457708 1 Stop Codon range2457708 1 790 795 annotation2457706 1 DsRed range2457706 1 115 792 annotation2457703 1 lacO range2457703 1 9 25 BBa_K1639009_sequence 1 ggagtcaattgtgagcggataacaattccacactcgaccctaggttgtgtcgcgagtgttggatcgcagctgacaccaattgtgagcgctaacaattgagtcgtcgacgccaccatggacaacaccgaggacgtcatcaaggagttcatgcagttcaaggtgcgcatggaaggctccgtgaacggccattacttcgagatcgagggcgaaggcgagggcaagccctacgagggcacccagaccgccaagctccaggtgaccaagggcggccccctgcccttcgcctgggacatcctgtccccccagttccagtacggctccaaggcctacgtgaagcacccggccgacatccccgactacatgaagctgtccttccccgagggcttcacctgggaacgctccatgaacttcgaggatggcggcgtggtggaagtgcagcaggactcctccctccaggatggcaccttcatctacaaggtgaagttcaagggcgtgaacttccccgccgacggccccgtaatgcagaagaagactgccggctgggagccctccaccgagaagctgtacccccaggacggcgtgctgaagggcgagatctcccacgccctgaagctgaaggacggcggccactacacctgcgacttcaagaccgtgtacaaggccaagaagcccgtgcagctgcccggcaaccactacgtggactccaagctggacatcaccaaccacaacgaggactacaccgtggtggagcagtacgagcacgccgaggcccgccactccggctcccagtagtaatccggaagcctatcctggattacttgaaacgcgtgacatgcggccgctcacgcgagccgaacgaacaaatccggagacatggatccg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z