BBa_K1641013 1 BBa_K1641013 SloxM1, modified recognition site of recombinase Scre 2015-09-09T11:00:00Z 2015-09-10T02:50:51Z De novo synthesis. This is a recognition site of Cre-like recombinase Scre, that is "CTCGTGTCCGATA ACTGTAAT TATCGGACACGAG". The original recognition site of Scre is SloxP, "CTCGTGTCCGATA ACTGTAAT TATCGGACATGAT", contains ATG that might be used as Met to start translation. So two mutation is conducted to avoid ATG and although this generates slight mismatch, this will not significantly reduce the activity of Scre on this site. This recognition site is not homologous with LoxP and hence will not cross-react with Cre or other common recombinases. Note: The brick sequence starts directly after the XbaI of prefix and ends before SpeI of the Suffix, without the useless bases (G and T respectively) added before and after brick sequence. The scar will be "ACTAGA" safely without cutting activity and start code. with This deletion do not interfere the usage of the brick. false false _2058_ 20036 20036 9 false SloxM1, a mutation of SloxP, eliminates ATG inside the sequence and avoids unexpected translation. false Pai Li BBa_K1641013_sequence 1 ctcgtgtccgataactgtaattatcggacacgag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z