BBa_K1641025 1 BBa_K1641025 Reporter of Invertase activity of Cre, pInv-rep-106LoxM 2015-09-11T11:00:00Z 2015-09-12T03:56:21Z All reporter is constructed as following pattern: Constructive promoter :: RTS :: up-side-down RBS-mcherry-(ssra) :: RTS :: terminator This is a reporter of invertase activity of Cre for Real-time measurement of dynamics of timing modules by SYSU-CHINA 2015. The target sequence LoxP of Cre locates in the pInv-rep, surrounding a mcherry gene which is yet upside-down and transcribed by a constructive promoter. This mcherry-coding sequence can be inverted and restored to 5??? ??? 3??? direction at the existence of Cre or its EGFP fusion, rendering red signal. By real-time measurement of EGFP and mcherry, we can obtain data of Cre dynamics and simulate this process through modelling. For this reporter: RTS type: LoxP mcherry type: BBa_J06504-BBa_M0052, which is mcherry-ssra(moderately fast) Promoter type: BBa_J23106 false false _2058_ 20036 20036 9 false This brick is constructed through cut-and-link of other bricks, without risky sources. false Pai Li component2452515 1 BBa_J23106 component2452527 1 BBa_B0015 component2452520 1 BBa_K1641014 annotation2452527 1 BBa_B0015 range2452527 1 897 1025 annotation2452520 1 BBa_K1641014 range2452520 1 44 888 annotation2452515 1 BBa_J23106 range2452515 1 1 35 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_J23106 1 BBa_J23106 constitutive promoter family member 2006-08-13T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1641014 1 BBa_K1641014 Up-side-down RBS::mcherry-ssra with loxP recognition sites. 2015-09-09T11:00:00Z 2015-09-10T07:33:10Z RBS and loxP are added to mcherry by cut-and-link or PCR. This is a special RBS::mcherry-ssra inverted into up-side-down form, with two LoxP sites at the upstream and downstream of the gene. LoxP can be recognized and the middle sequence can be restored by invertase Cre. Ssra-tag in this sequence is moderately fast type (BBa_M0052) that accelerates the degradation but at a speed far less than expression. This part can be used to construct the reporter for real-time invertase dynamics analysis. false false _2058_ 20036 20036 9 false This sequence is up-side-down, hence can be inverted into normal sequence. false Pai Li annotation2448566 1 BBa_B0034 range2448566 1 794 805 annotation2448565 1 Inverted mcherry-ssra range2448565 1 44 787 annotation2448567 1 LoxP range2448567 1 812 845 annotation2448564 1 LoxP range2448564 1 1 34 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1641014_sequence 1 ataacttcgtatagcatacattatacgaagttatactagattattaagaagcgtcagcgtagttttcgtcgttagcagccttgtacagctcgtccatgccgccggtggagtggcggccctcggcgcgttcgtactgttccacgatggtgtagtcctcgttgtgggaggtgatgtccaacttgatgttgacgttgtaggcgccgggcagctgcacgggcttcttggccttgtaggtggtcttgacctcagcgtcgtagtggccgccgtccttcagcttcagcctctgcttgatctcgcccttcagggcgccgtcctcggggtacatccgctcggaggaggcctcccagcccatggtcttcttctgcattacggggccgtcggaggggaagttggtgccgcgcagcttcaccttgtagatgaactcgccgtcctgcaaggaggagtcctgggtcacggtcaccacgccgccgtcctcgaagttcatcacgcgctcccacttgaagccctcggggaaggacagcttcaagtagtcggggatgtcggcggggtgcttcacgtaggccttggagccgtacatgaactgaggggacaggatgtcccaggcgaagggcagggggccacccttggtcaccttcagcttggcggtctgggtgccctcgtaggggcggccctcgccctcgccctcgatctcgaactcgtggccgttcacggagccctccatgtgcaccttgaagcgcatgaactccttgatgatggccatgttatcctcctcgcccttgctcaccattctagttttctcctcttttctagtataacttcgtataatgtatgctatacgaagttat BBa_K1641025_sequence 1 tttacggctagctcagtcctaggtatagtgctagctactagagataacttcgtatagcatacattatacgaagttatactagattattaagaagcgtcagcgtagttttcgtcgttagcagccttgtacagctcgtccatgccgccggtggagtggcggccctcggcgcgttcgtactgttccacgatggtgtagtcctcgttgtgggaggtgatgtccaacttgatgttgacgttgtaggcgccgggcagctgcacgggcttcttggccttgtaggtggtcttgacctcagcgtcgtagtggccgccgtccttcagcttcagcctctgcttgatctcgcccttcagggcgccgtcctcggggtacatccgctcggaggaggcctcccagcccatggtcttcttctgcattacggggccgtcggaggggaagttggtgccgcgcagcttcaccttgtagatgaactcgccgtcctgcaaggaggagtcctgggtcacggtcaccacgccgccgtcctcgaagttcatcacgcgctcccacttgaagccctcggggaaggacagcttcaagtagtcggggatgtcggcggggtgcttcacgtaggccttggagccgtacatgaactgaggggacaggatgtcccaggcgaagggcagggggccacccttggtcaccttcagcttggcggtctgggtgccctcgtaggggcggccctcgccctcgccctcgatctcgaactcgtggccgttcacggagccctccatgtgcaccttgaagcgcatgaactccttgatgatggccatgttatcctcctcgcccttgctcaccattctagttttctcctcttttctagtataacttcgtataatgtatgctatacgaagttattactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23106_sequence 1 tttacggctagctcagtcctaggtatagtgctagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z