BBa_K1666006 1 BBa_K1666006 lsr promoter of LuxS/AI-2 signaling pathway in Salmonalla 2015-09-05T11:00:00Z 2015-09-18T08:16:38Z We extracted the genomic DNA of Salmonella enterica subsp. enterica serovar Typhimurium str. LT2, and used PCR to isolate the promoter plsr. Quorum sensing is a process of bacterial cell-to-cell communication involving the production and detection of extracellular signaling molecules called autoinducers. And autoinducer-2 (AI-2) has been proposed to serve as a 'universal signal' for interspecies communication. In the LuxS/AI-2 signaling system of Salmonella Typhimurium, AI-2 response involves ATP binding cassette transporter encoded by genes named Lsr (LuxS regulated). And plsr is member of lsr operon which could be repressed by LsrR. In our project, we set this promoter part in front of a blue pigment as a reporter monitoring the presence of AI-2. false false _2084_ 28478 23948 9 false The lsrD gene was isolated from the genome of Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 using PCR. We added restriction enzyme sites when designing primers, and the assembly is done through the use of restriction sites (cutting and ligating). false Heming Wang annotation2445166 1 plsr range2445166 1 1 255 BBa_K1666006_sequence 1 tgtcataacctggctttactttgaacatttctaaatcattaacacaattgttcagttatcactccgaaataaccgtgattaacgccacaaaaacgcgccaaatctgaacatttatcatctaaaaattcatttattcagaaaacgtgatctggatgagagttttttgaccaaataactactaccgttttgaacaatttctttttcaaaaaacatttgttcagtcccgtcagtcaacattgagggagcggaggcaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z