BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation1683 1 stem_loop range1683 1 13 35 annotation7019 1 BBa_B0011 range7019 1 1 46 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 BBa_K1669005 1 BBa_K1669005 CtfB with double terminator 2015-09-12T11:00:00Z 2015-09-13T02:11:07Z / CtfB gene fused with double terminator. false false _2087_ 26210 26210 9 false / false Nina Jerala component2453319 1 BBa_K823017 component2453311 1 BBa_K1669003 annotation2453311 1 BBa_K1669003 range2453311 1 1 687 annotation2453319 1 BBa_K823017 range2453319 1 696 790 BBa_K1669003 1 BBa_K1669003 CtfB + His-tag 2015-09-12T11:00:00Z 2015-09-13T02:03:36Z Sequence retrieved from GenBank and codon optimized for expression in E. coli This part includes the CtfB gene from Clostridium acetobutylicum (NCBI: CAP0163) with a C-terminal His-tag, which has been codon optimized for expression in E. coli. This is one of the two polipeptide chains forming the CtfAB (CoA-transferase) enzyme, that is in Clostridium acetobutylicum responsible for conversion of butyrate to butyril-CoA. The sequence contains a C-terminal His-tag for purification of the protein using the mmobilized-metal affinity chromatography and detected with the anti-His antibodyes. false false _2087_ 26210 26210 9 false C-terminal His-tag. false Nina Jerala annotation2453290 1 ATG range2453290 1 1 3 annotation2453293 1 double stop codon range2453293 1 683 687 annotation2453291 1 CtfB range2453291 1 1 673 annotation2453292 1 His-tag range2453292 1 674 682 BBa_B0014 1 BBa_B0014 double terminator (B0012-B0011) 2003-07-15T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0012 and BBa_B0011 false true _1_ 0 24 7 In stock false true Reshma Shetty component939303 1 BBa_B0012 component939311 1 BBa_B0011 annotation939303 1 BBa_B0012 range939303 1 1 41 annotation939311 1 BBa_B0011 range939311 1 50 95 BBa_K823017 1 BBa_K823017 double terminator (B0012-B0011) 2012-09-10T11:00:00Z 2015-05-08T01:13:30Z Part:BBa_B0014 Released HQ 2013 This is a copy of the [[Part:B0014|Part:B0014]]. Only here the part is cloned in the standard vector pSB1C3 instead of the pSB1AK3. false false _1081_ 0 11555 9 In stock false This is a copy of the [[Part:B0014|Part:B0014]]. Only here the part is cloned in the standard vector pSB1C3 instead of the pSB1AK3. false Jara Radeck component2182657 1 BBa_B0014 annotation2182657 1 BBa_B0014 range2182657 1 1 95 BBa_B0014_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_K1669005_sequence 1 atgattaatgataaaaatcttgccaaggaaatcatcgcgaaacgcgtggcgcgggaacttaaaaatggccagctggtgaacctgggcgttggcctgccgaccatggtagcggattatatcccgaaaaattttaaaatcacctttcagagcgagaacgggattgtgggtatgggcgcatcaccaaaaattaatgaagccgataaagatgttgtgaatgcgggtggcgattacaccacggtgttgcctgatggtacgttcttcgatagcagcgtgtctttttcgcttatccgcggtggccacgtagatgtaacggtgctcggtgcgttacaggtggacgaaaagggtaatatcgcgaactggatcgtccctggtaagatgctgtccggaatgggtggtgcaatggatcttgtcaacggcgctaagaaagttattattgccatgcgtcacacgaacaagggacagccgaaaatccttaaaaagtgcaccttgccacttacggcgaaatcacaagcaaatctcattgtgactgaactgggcgtgatcgaagtgattaatgacggcctgttgctgacagaaatcaacaaaaacacgaccatcgatgaaattcgtagtctgactgccgccgatctgcttattagcaacgaactgcgcccgatggcggtgcatcaccatcatcaccattaataatactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_K823017_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_K1669003_sequence 1 atgattaatgataaaaatcttgccaaggaaatcatcgcgaaacgcgtggcgcgggaacttaaaaatggccagctggtgaacctgggcgttggcctgccgaccatggtagcggattatatcccgaaaaattttaaaatcacctttcagagcgagaacgggattgtgggtatgggcgcatcaccaaaaattaatgaagccgataaagatgttgtgaatgcgggtggcgattacaccacggtgttgcctgatggtacgttcttcgatagcagcgtgtctttttcgcttatccgcggtggccacgtagatgtaacggtgctcggtgcgttacaggtggacgaaaagggtaatatcgcgaactggatcgtccctggtaagatgctgtccggaatgggtggtgcaatggatcttgtcaacggcgctaagaaagttattattgccatgcgtcacacgaacaagggacagccgaaaatccttaaaaagtgcaccttgccacttacggcgaaatcacaagcaaatctcattgtgactgaactgggcgtgatcgaagtgattaatgacggcctgttgctgacagaaatcaacaaaaacacgaccatcgatgaaattcgtagtctgactgccgccgatctgcttattagcaacgaactgcgcccgatggcggtgcatcaccatcatcaccattaataa BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z