BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K608002 1 BBa_K608002 strong Promoter and strong RBS 2011-09-14T11:00:00Z 2015-05-08T01:12:52Z assembly from iGEM parts Released HQ 2013 you can insert your part behind this part so it will be immediatly expressed in e.coli. false false _780_ 0 9115 9 In stock false cloning via 3a-assembly false Julia M??ller component2128646 1 BBa_J23104 component2128648 1 BBa_B0034 annotation2128646 1 BBa_J23104 range2128646 1 1 35 annotation2128648 1 BBa_B0034 range2128648 1 44 55 BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation1683 1 stem_loop range1683 1 13 35 annotation7019 1 BBa_B0011 range7019 1 1 46 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 BBa_K1669007 1 BBa_K1669007 CtfA with strong promotor, strong RBS and double terminator 2015-09-12T11:00:00Z 2015-09-13T02:17:01Z / CtfA fused with strong promotor, strong RBS and double terminator. false false _2087_ 26210 26210 9 false / false Nina Jerala component2453341 1 BBa_K1669001 component2453336 1 BBa_K608002 component2453349 1 BBa_K823017 annotation2453349 1 BBa_K823017 range2453349 1 748 842 annotation2453341 1 BBa_K1669001 range2453341 1 62 739 annotation2453336 1 BBa_K608002 range2453336 1 1 55 BBa_J23104 1 BBa_J23104 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z isolated from library of promoters replace later false false _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0014 1 BBa_B0014 double terminator (B0012-B0011) 2003-07-15T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0012 and BBa_B0011 false true _1_ 0 24 7 In stock false true Reshma Shetty component939303 1 BBa_B0012 component939311 1 BBa_B0011 annotation939303 1 BBa_B0012 range939303 1 1 41 annotation939311 1 BBa_B0011 range939311 1 50 95 BBa_K1669001 1 BBa_K1669001 CtfA + His-tag 2015-09-11T11:00:00Z 2015-09-12T01:47:27Z Sequence retrieved from GenBank and codon optimized for expression in E. coli. This part includes the CtfA gene from Clostridium acetobutylicum (NCBI: CAP0163) with a C-terminal His-tag, which has been codon optimized for expression in E. coli. This is one of the two polipeptide chains forming the CtfAB (CoA-transferase) enzyme, that is in Clostridium acetobutylicum responsible for conversion of butyrate to butyril-CoA. The sequence contains a C-terminal His-tag for purification of the protein using the mmobilized-metal affinity chromatography and detected with the anti-His antibodyes. false false _2087_ 27546 27546 9 false Codon optimization for expression in E. coli. Added C-terminal His-tag. false Marina Klemencic annotation2452401 1 CtfA range2452401 1 1 649 annotation2452399 1 double stop codon range2452399 1 669 673 annotation2452400 1 His-tag range2452400 1 650 668 annotation2452398 1 ATG range2452398 1 1 3 BBa_K823017 1 BBa_K823017 double terminator (B0012-B0011) 2012-09-10T11:00:00Z 2015-05-08T01:13:30Z Part:BBa_B0014 Released HQ 2013 This is a copy of the [[Part:B0014|Part:B0014]]. Only here the part is cloned in the standard vector pSB1C3 instead of the pSB1AK3. false false _1081_ 0 11555 9 In stock false This is a copy of the [[Part:B0014|Part:B0014]]. Only here the part is cloned in the standard vector pSB1C3 instead of the pSB1AK3. false Jara Radeck component2182657 1 BBa_B0014 annotation2182657 1 BBa_B0014 range2182657 1 1 95 BBa_B0014_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_K1669001_sequence 1 atgaatagcaaaattattcgtttcgaaaacctgcgtagctttttcaaggatgggatgaccattatgatcggggggttcttaaattgtgggacaccaaccaaactgattgattttctcgtgaacctgaatattaaaaacttgacaattatcagcaacgacacctgctaccctaacaccggtatcggcaaactgatctcaaataaccaggtgaaaaaattgattgcctcctacatcggctccaatccggatactggcaaaaaactgttcaataacgaacttgaggttgaactgagcccccaaggtacccttgtggaacgtattcgtgcggggggttccggtttaggtggtgttttaacgaaaacgggtttgggaacactgatcgaaaaaggtaagaaaaagatcagtatcaatgggaccgaataccttttagaattgccactgactgccgatgttgcactcattaagggcagcatcgtggatgaagcaggcaatacattctataaaggcactaccaaaaactttaacccctatatggctatggccgcaaaaaccgtgattgttgaagccgagaatctcgtgtcttgtgaaaaactggaaaaagaaaaggccatgaccccgggtgtcttgattaattacatcgtaaaagagccggcacatcaccatcatcaccattaataa BBa_B0034_sequence 1 aaagaggagaaa BBa_K608002_sequence 1 ttgacagctagctcagtcctaggtattgtgctagctactagagaaagaggagaaa BBa_K1669007_sequence 1 ttgacagctagctcagtcctaggtattgtgctagctactagagaaagaggagaaatactagatgaatagcaaaattattcgtttcgaaaacctgcgtagctttttcaaggatgggatgaccattatgatcggggggttcttaaattgtgggacaccaaccaaactgattgattttctcgtgaacctgaatattaaaaacttgacaattatcagcaacgacacctgctaccctaacaccggtatcggcaaactgatctcaaataaccaggtgaaaaaattgattgcctcctacatcggctccaatccggatactggcaaaaaactgttcaataacgaacttgaggttgaactgagcccccaaggtacccttgtggaacgtattcgtgcggggggttccggtttaggtggtgttttaacgaaaacgggtttgggaacactgatcgaaaaaggtaagaaaaagatcagtatcaatgggaccgaataccttttagaattgccactgactgccgatgttgcactcattaagggcagcatcgtggatgaagcaggcaatacattctataaaggcactaccaaaaactttaacccctatatggctatggccgcaaaaaccgtgattgttgaagccgagaatctcgtgtcttgtgaaaaactggaaaaagaaaaggccatgaccccgggtgtcttgattaattacatcgtaaaagagccggcacatcaccatcatcaccattaataatactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_K823017_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_J23104_sequence 1 ttgacagctagctcagtcctaggtattgtgctagc BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z