BBa_K1677369 1 BBa_K1677369 MMTV Pseudoknot 2015-08-24T11:00:00Z 2015-08-25T01:11:11Z It is extracted from the Mouse mammary tumor virus. This is part of the BABS iGEM pseudoknot suite. This pseudoknot can be used for delayed translation of a protein sequence, by slowing the ribosome. false false _2095_ 24918 24918 9 false All start codons had to be removed from the pseudoknot false Isabelle Capell-Hattam annotation2466084 1 5' Flanking Sequence range2466084 1 54 74 annotation2466082 1 3' Flanking Sequence range2466082 1 1 20 annotation2466087 1 MMTV Pseudoknot range2466087 1 20 54 BBa_K1677369_sequence 1 aaattcaaaaaacttgtaaaggggcagtcccctagccccactcaaaagggggataaaggtaaggactcaggatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z