BBa_K1677743 1 BBa_K1677743 TGV Pseudoknot 2015-08-24T11:00:00Z 2015-08-25T02:16:32Z Transmissible gastroenteritis virus This is part of the BABS iGEM pseudoknot suite. This pseudoknot can be used for delayed translation of a protein sequence, by slowing the ribosome. false false _2095_ 24918 24918 9 false All start codons had to be removed from the pseudoknot. 20 base pairs from the viral DNA flank either side of the pseudoknot region. <br> 3' flanking sequence ATCAAAGTTATTTAAACGAG <br> 5' flanking sequence TTTGACATCTACAACAAAGA <br> The actual pseudoknot is: <br> UGCGGGGUUCUAGUGCAGCUCGACUAGAACCCUGCAUUGGUACUGAUCCAGACCAAGUUAGUAGAGCU <br> ((((((((((((((..[[[[[.))))))))))))))(((((.(((...)))))))).......]]]]] <br> Estimated free energy: -33.47 kcal/mol false Isabelle Capell-Hattam annotation2466139 1 5' Flanking Region range2466139 1 88 108 annotation2466140 1 TGV Pseudoknot range2466140 1 20 88 annotation2466138 1 3' Flanking Region range2466138 1 1 20 BBa_K1677743_sequence 1 atcaaagttatttaaacgagtgcggggttctagtgcagctcgactagaaccctgcattggtactgatccagaccaagttagtagagcttttgacatctacaacaaaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z