BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K115001 1 BBa_K115001 RNA thermometer (ROSE) 2008-07-14T11:00:00Z 2015-05-08T01:09:27Z This sequence is taken from the Bradirhizobium Japonicum (BA000040.) as the 5'UTR (ROSE) of a heat shock protein (prfA). Released HQ 2013 This part is designed as a temperature inducible RBS. Only designed so far. false false _223_ 0 3007 9 In stock true The secondary structure is important to the function of these regions, but part of the wt secondary structure is destroyed by the scar. We've tried to alter the sequence so the predicted structure (through mfold and those kind of servers) is sort of conserved, but temperature sensitivity still has to be tested. If it doesn't work, possible solution might be the addition of a larger conserved part of the wt, which implies a small part of wt protein sequence as well. true O.M.J.A. Stassen annotation1966896 1 SD range1966896 1 90 95 annotation1966926 1 Predicted Stem Loop range1966926 1 1 15 annotation1966927 1 Predicted Stem Loop range1966927 1 16 36 annotation1966928 1 Predicted Stem Loop range1966928 1 39 71 annotation1966898 1 Biobrick-Scar-adaptation range1966898 1 74 79 annotation1966929 1 Predicted Stem Loop extending to startcodon range1966929 1 72 96 BBa_E1010 1 mRFP1 **highly** engineered mutant of red fluorescent protein from Discosoma striata (coral) 2004-07-27T11:00:00Z 2015-08-31T04:07:26Z Campbell et al., PNAS v99 p7877 <a href="http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=12060735">URL</a> Released HQ 2013 monomeric RFP: Red Fluorescent Protein. Excitation peak: 584 nm Emission peak: 607 nm false false _11_1_ 0 52 7 In stock false TAATAA double stop codon added (DE). Four silent mutations made to remove three EcoRI sites and one PstI site: A28G, A76G, A349G, G337A. true Drew Endy annotation1014044 1 mrfp1 range1014044 1 1 675 annotation2214014 1 Help:Barcodes range2214014 1 682 706 BBa_K1679007 1 BBa_K1679007 promoter+RNA thermometer+RFP 2015-09-06T11:00:00Z 2015-09-18T09:12:20Z It is made up of three parts. This is a reporter that it can product RFP when the temperature is 42??C.We use an RNA thermometer(K115001) which can be used for temperature sensitive post-transcriptional regulation at 42??C as our RBS.We add a promoter(J23101) and an RFP(E1010) to make bacterium becoming red when the temperature is 42??C or higher. false false _2097_ 25071 25070 9 false We use a special RBS to make it temperature-sensitive false Cun Wei component2467073 1 BBa_K115001 component2467076 1 BBa_E1010 component2467066 1 BBa_J23101 annotation2467076 1 BBa_E1010 range2467076 1 146 851 annotation2467066 1 BBa_J23101 range2467066 1 1 35 annotation2467073 1 BBa_K115001 range2467073 1 44 139 BBa_K1679007_sequence 1 tttacagctagctcagtcctaggtattatgctagctactagaggccgcgacaagcggtccgggcgccctaggggcccggcggagacgggcgccggaggtgtccgacgcctgctcgtcaagttcttgctccttggaggattactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_K115001_sequence 1 gccgcgacaagcggtccgggcgccctaggggcccggcggagacgggcgccggaggtgtccgacgcctgctcgtcaagttcttgctccttggaggat BBa_E1010_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z