BBa_K1679025 1 BBa_K1679025 pT7-4 +RiboJ + GFP + LVA + 3 terminnators 2015-09-16T11:00:00Z 2015-09-18T08:08:49Z Synthesized by Genewiz. This device is design for protein expression and promoter measurement. It constructed with a T7 RNA polymerase which has other 3 mutations, a RiboJ, a green fluorescent protein, a LVA degradation tag, a T7 terminator, a rrnB T1 terminator and a rrnB T2 terminator. false false _2097_ 25072 25072 9 true This device is design for protein expression and promoter measurement. It constructed with a T7 RNA polymerase which has other 3 mutations, a RiboJ, a green fluorescent protein, a LVA degradation tag, a T7 terminator, a rrnB T1 terminator and a rrnB T2 terminator. We added restriction sites flank these segments, so that users can change this segments into what they prefer. Users can replace T7 with other promoters through SalI and HindIII; replace RiboJ and GFP with other coding sequence through HindIII and StuI. After transcription, RiboJ becomes a section of functional RNA which comprises the sTRSV- ribozyme which can excise its upstream fragment to reduce noise, and an additional 23-nt hairpin immediately downstream to help expose the RBS. We use it to buffer synthetic circuits from genetic context. To adapt the protein expression device, three terminators are design to use cooperatively with strong promoters, the LVA degradation tag can accelerate protein degradation rate to decrease cell stress. false Xihan Zhang annotation2469894 1 GFP range2469894 1 335 1048 annotation2469890 1 rrnB T2 terminator range2469890 1 18 45 annotation2469893 1 LVA range2469893 1 293 334 annotation2469892 1 T7 terminator range2469892 1 223 270 annotation2469895 1 rbs range2469895 1 1058 1062 annotation2469897 1 T7-4 promoter range2469897 1 1155 1172 annotation2469896 1 RiboJ range2469896 1 1074 1148 annotation2469891 1 rrnB T1 terminator range2469891 1 128 214 BBa_K1679025_sequence 1 gaaacgcaaaaaggccatccgtcaggatggccttctgcttagtttgatgcctggcagtttatggcgggcgtcctgcccgccaccctccgggccgttgcttcacaacgttcaaatccgctcccggcggatttgtcctactcaggagagcgttcaccgacaaacaacagataaaacgaaaggcccagtcttccgactgagcctttcgttttatttgatgcctggcaaaaaacccctcaagacccgtttagaggccccaaggggttatgctagttattgctcagcggtggcagcattaagccaccagtgcgtagttttcatcgttagcagcaggccttttatacagttcgtccatgccgtgggtgatacccgcagccgtcacaaattccagcaggaccatgtggtcacgtttttcgttcggatcttttgacagcacggactgggtactcaggtagtgattgtccggcagcaggaccgggccatcaccaatcggcgtgttttgctgatagtggtcggccagctgaacgctaccatcttccacattatggcggattttgaaattggctttaatgccgtttttctgtttatccgcggtgatgtacacgttgtgggaattgaagttatattccagtttatgacccagaatattgccgtcttctttgaaatcgatacctttcagttcgatacggttaaccagggtatcgccttcgaatttcacttccgcgcgggttttatacgtaccatcgtctttaaagctaatcgtacgttcctgcacatagccttccggcatggccgatttgaaaaagtcgtgctgtttcatgtgatccgggtaacgcgcaaaacattgaacgccataggtcagcgtggtcaccagcgtcggccacgggaccggcagtttacccgtggtgcagataaatttcagggtcagtttgccgttcgtcgcatcgccttcaccttcgccgcgaacactgaatttatgaccattaacatcgccgtccagttccaccagaatcggaaccacaccggtaaacagttcttcgcctttacgcatatgtatatctccttcttaaagttaattaaacaaaattatttgtagaggctgtttcgtcctcacggactcatcagaccggaaagcacatccggtgacagctaagcttctataatgagtcgtattagtcgac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z