BBa_K1680013 1 BBa_K1680013 NDegron 2015-09-16T11:00:00Z 2015-10-27T01:42:39Z gBlock designed by Team Tuebingen Protein coding region for the firefly [Photinus pyralis] luciferase, codon optimized for yeast. false false _2098_ 15693 26460 9 false Shipped in RFC10 false Katharina Sporbeck annotation2477347 1 NDegron range2477347 1 1 165 annotation2477348 1 SV40 NLS range2477348 1 13 33 annotation2477352 1 Spacer range2477352 1 34 66 annotation2477350 1 NDegron range2477350 1 97 138 annotation2477351 1 Nuclear export sequence range2477351 1 130 147 annotation2477349 1 TEV cleavage sites range2477349 1 67 86 BBa_K1680013_sequence 1 atggccggcccccctaagaaaaagagaaaagtcagcattacaagtttgtacaaaaaagccggttctgagaatctgtatttccagttccacaagagcggcgcttggaagctaccagtttccctggtcaagttgggtcttgataagttagattataagaccggttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z