BBa_K1701003 1 PtasA PtasA 2015-09-07T11:00:00Z 2015-09-08T05:54:37Z http://www.ncbi.nlm.nih.gov/nuccore/223666305?report=graph The PtasA gene is the promoter of the TasA gene, and the TasA gene codes for the protein TasA. false false _2119_ 21319 21319 9 false None false Wei Wei BBa_K1701003_sequence 1 cttcagttgtaaacctggcaacaggtttcgatataaaatcattcaataaaaggggagcttacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z