BBa_K1704000 1 BBa_K1704000 Epitope 2 from ara h 1 (peanut protein) 2015-09-16T11:00:00Z 2015-09-17T05:40:46Z It comes from the peanut protein ara h 1. Epitope 2 from ara h 1 with a his-tag and a GS-linker so it is easily merged with other proteins (after removing/circumvention the problem with a stop codon, that appears when assembling biobricks, that is). false false _2123_ 26637 26637 9 false We used a his-tag so this protein or the one merged with it could be purified using a nickel colonn. false Max Lindberg BBa_K1704000_sequence 1 atgcatcatcatcatcatcatagcagcggtgttgatctgggtaccgaaaatctgtattttcagagcatgcaggaaccggatgatctgaaacagaaagcaggttcaggatcgggttctggttcggggtct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z