BBa_K1722000 1 hUPll hUPll is a bladder tissue-specific promoter . 2015-08-25T11:00:00Z 2015-09-09T02:02:31Z hUPII gene was achieved from Shenzhen Second People's Hospital. We read a scientific treatise talking about targeted therapy of bladder cancer written by a doctor in Shenzhen Second People's Hospital and tried to seek cooperation with them. Fortunately, they agree to provide us hUPII with psi-Check2 as its vector. Uroplakin II (UPII) has been characterized as a bladder tissue-specific protein and the expression of uroplakin II was found to be limited to bladder-derived cells. 2015 SZU-iGEM use hUPII to drive the expression of the therapeutic genes(such as p21 and Bax) so that the gene is expressed only in bladder cells and systematic toxicity is minimized. We tested hUPII gene in HFC(Human Fiber Epithelial Cells)，5637，T24 and Hela cell lines and found it can confer preferential expression of genes in the bladder urothelium like HFC, which are normal bladder cells, 5637 and T24, which are bladder cancer cells. false false _2142_ 26634 26634 9 false We designed the following primers and amplified hUPII promoter from the vector psi-Check2: CCGGAATTCATCGGGTGATCAGTACTCC TGCACTGCAGACTAGTACTGAGCTGTGAGGT By incorporating these primers into hUPII promoter, the promoter is flanked by the iGEM prefix and suffix after amplification. false Yin Xiao BBa_K1722000_sequence 1 catcgggggagcagtcctccaaggactggccagtctccagatgcccgtgcacacaggaacactgccttatgcacgggagtcccagaagaaggggtgatttctttccccaccttagttacaccatcaagacccagccagggcatcccccctcctggcctgagggccagctccccatcctgaaaaacctgtctgctctccccacccctttgaggctatagggcccaaggggcaggttggactggattcccctccagcccctcccacccccaggacaaaatcagccaccccaggggcagggcctcacttgcctcaggaaccccagcctgccagcacctattccacctcccagcccagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z