BBa_K1365020 1 BBa_K1365020 sfGFP(Bs) 2014-09-23T11:00:00Z 2015-05-08T01:10:07Z PCR on plasmid MG_sfgfp(Bs), used in the study 'Benchmarking Various Green Fluorescent Protein Variants in Bacillus subtilis, Streptococcus pneumoniae, and Lactococcus lactis for Live Cell Imaging', see references. Plasmid kindly provided by the Molecular Genetics group of the Rijksuniversiteit Groningen. Codes for the sfGFP protein, an optimized fluorescent reporter. Was originally optimized for Bacillus subtilis, but then showed high fluorescence in Lactococcus lactis. false false _1741_ 0 23000 9 In stock false Used primers: forward - 5'-GTTTCTTCGAATTCGCGGCCGCTTCTAGATGTCAAAAGGAGAAGAGCT-3' reverse - 5'-GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTACTTATAAAGCTCAT-3' to PCR sfGFP(Bs) from the plasmid and add the BioBrick prefix and suffix. false Sandra Mous annotation2420000 1 sfGFP(Bs) range2420000 1 1 717 annotation2419999 1 start range2419999 1 1 1 annotation2420001 1 stop range2420001 1 715 717 BBa_K1722008 1 hTERT+GFP hTERT+GFP Composite 2015-08-31T11:00:00Z 2015-09-07T09:00:00Z This composite part is assembled using hTERT and GFP. hTERT promoter is achieved from Shenzhen Second People's Hospital and GFP is achieved from 2015 Distribution Kit. We constructed the two DNA sequence in pSB1C3, the required vector. Telomere is a special structure in eukaryotic chromosome consisting of (TTAGGG)n and telomere binding protein. Telomerase is a kind of reverse transcript DNA polymerase rely on RNA. It can synthesize repeating nucleotide sequence and add it to the end of the chromosome to maintain the telomere. In this way, cells with telomerase can proliferate limitless and be immortalized. The human telomerase enzyme complex consists of human telomerase reverse transcriptase(hTERT) and human telomerase RNA(hTR). hTR is expressed in almost all cells while hTERT express only in tumor cells and other immortal cells. hTERT promoter, which has tumor specificity, has significantly higher transcription activity in telomerase positive tumor cells. Research shows that targeted gene therapy based on hTERT promoter can selectively kill telomerase positive tumor cells with no influence on normal cells. In this plasmid, we construct hTERT with Green Fluorescent Protein(GFP), which is a widely used reporter gene. When hTERT promoter is activated, GFP is produced and be oxidized to fluoresce. By inserting this plasmid into T24 and 5637, two lines of bladder cancer cells, we are able to acquire GFP. Green fluorescent light is detected using confocal laser scanning microscopy. This indicates that hTERT promoter is able to be activated inside bladder cancer cells. false false _2142_ 20403 26634 9 false The hTERT promoter that is achieved from Shenzhen Sencond People's Hospital is constructed in psi-Check2 vector. To assemble it with GFP and pSB1C3, we have to design primers with certain restriction enzyme cutting site and amplify it. Then assemble the three parts using 3A Assembly Method. false Shuang Liang component2442676 1 BBa_K1722002 component2442679 1 BBa_K1365020 annotation2442676 1 BBa_K1722002 range2442676 1 1 454 annotation2442679 1 BBa_K1365020 range2442679 1 461 1177 BBa_K1722002 1 BBa_K1722002 hTERT is a tumor specific promoter. 2015-08-31T11:00:00Z 2015-09-07T08:15:36Z The telomerase reverse transcriptase promoter can be found in human cancer cells. In our experiment, we got the part from Shenzhen Second People's Hospital. Additionally, the verification of our system's function was also carried out in Shenzhen Second People's Hospital. hTERT is a tumor specific promoter which is short for human telomerase reverse transcriptase. The human telomerase enzyme complex consists of human telomerase reverse transcriptase(TERT), telomerase RNA(TR) and dyskerin(DKCI). This class of enzyme can catalyze the adding of (TTAGGG)n to the 3' end of telomeres to elongate the telomeres, thus prolonging cells' life. Researches show that the telomerase activity is based mostly on the expression level of TERT instead of that of TR and TEP. High telomerase activities are tested on most high proliferation cells such as tumor cells and stem cells. The core region of hTERT promoter lies on the 181bp sequence upstream of transcriptional start site, involving several binding sites for transcriptional factors, like sp1, cmyc, p53 and mad1. Researches show that hTERT promoters are activated in tumor cells that are telomerase positive while being inhibited in normal cells that are telomerase negative, which indicates that hTERT promoter may specifically target at tumor cells. Gu et al found the transcriptional activity of CMV promoter was almost 500 times higher than that of hTERT promoter in normal cells. However, the magnification shrinked to only 5-20 in tumor cells. So in this study, we choose hTERT as a promoter to specifically recognise cancer cells to express the downstream effector. We constructed hTERT and GFP in the same plasmid and inserted the plasmid into T24, a bladder cancer cell line, to test if hTERT can be activated inside the cell. Luckily, we saw green fluorescent light using confocal laser scanning microscopy. false false _2142_ 20403 26634 9 false We designed the following primers and amplified hTERT promoter from the vector psi-Check2:Up: CCGGAATTCGGCACCTCCCTCGGGTTAG Down: TGCACTGCAGACTAGTCGCGTGGGTGGCCG. By incorporating these primers into hTERT promoter, the promoter is flanked by the iGEM prefix and suffix after amplification. false Hao Wang BBa_K1722002_sequence 1 ggcccctccctcgggttaccccacagcctaggccgattcgacctctctccgctggggccctcgctggcgtccctgcaccctgggagcgcgagcggcgcgcgggcggggaagcgcggcccagacccccgggtccgcccggagcagctgcgctgtcggggccaggccgggctcccagtggattcgcgggcacagacgcccaggaccgcgctccccacgtggcggagggactggggacccgggcacccgtcctgccccttcaccttccagctccgcctcctccgcgcggaccccgccccgtcccgacccctcccgggtccccggcccagccccctccgggccctcccagcccctccccttcctttccgcggccccgccctctcctcgcggcgcgagtttcaggcagcgctgcgtcctgctgcgcacgtgggaagccctggccccggccacccccgcg BBa_K1365020_sequence 1 atgtcaaaaggagaagagctgttcacaggtgttgtgccgattctcgttgagcttgacggagatgtaaacggacacaaattctctgttcgcggtgaaggtgaaggagatgcaacaaacggcaagctgacattgaagtttatttgcacaactggaaagctgccggttccttggccgacacttgtaacgacgctgacttacggcgttcaatgcttctctcgttatccagaccacatgaaacgccatgatttcttcaaatctgcaatgcctgaaggctacgttcaagagcgtacgatcagcttcaaagatgacggaacgtacaaaacaagagcagaagtgaagtttgaaggtgacacacttgtgaaccgcattgaattgaaaggcattgatttcaaagaagatggaaacatccttggacacaaacttgaatacaacttcaacagccacaacgtatacatcactgctgacaaacaaaaaaacggcatcaaagcaaacttcaaaatccgtcataacgtagaggacggttctgttcagcttgctgatcattatcagcaaaatacaccgatcggtgacggcccggttcttcttcctgataaccattatttatcaactcaaagcgtattatcaaaagacccaaatgaaaagcgtgaccacatggtgctgcttgaatttgtgacagctgctggtatcactcacggcatggatgagctttataagtaa BBa_K1722008_sequence 1 ggcccctccctcgggttaccccacagcctaggccgattcgacctctctccgctggggccctcgctggcgtccctgcaccctgggagcgcgagcggcgcgcgggcggggaagcgcggcccagacccccgggtccgcccggagcagctgcgctgtcggggccaggccgggctcccagtggattcgcgggcacagacgcccaggaccgcgctccccacgtggcggagggactggggacccgggcacccgtcctgccccttcaccttccagctccgcctcctccgcgcggaccccgccccgtcccgacccctcccgggtccccggcccagccccctccgggccctcccagcccctccccttcctttccgcggccccgccctctcctcgcggcgcgagtttcaggcagcgctgcgtcctgctgcgcacgtgggaagccctggccccggccacccccgcgtactagatgtcaaaaggagaagagctgttcacaggtgttgtgccgattctcgttgagcttgacggagatgtaaacggacacaaattctctgttcgcggtgaaggtgaaggagatgcaacaaacggcaagctgacattgaagtttatttgcacaactggaaagctgccggttccttggccgacacttgtaacgacgctgacttacggcgttcaatgcttctctcgttatccagaccacatgaaacgccatgatttcttcaaatctgcaatgcctgaaggctacgttcaagagcgtacgatcagcttcaaagatgacggaacgtacaaaacaagagcagaagtgaagtttgaaggtgacacacttgtgaaccgcattgaattgaaaggcattgatttcaaagaagatggaaacatccttggacacaaacttgaatacaacttcaacagccacaacgtatacatcactgctgacaaacaaaaaaacggcatcaaagcaaacttcaaaatccgtcataacgtagaggacggttctgttcagcttgctgatcattatcagcaaaatacaccgatcggtgacggcccggttcttcttcctgataaccattatttatcaactcaaagcgtattatcaaaagacccaaatgaaaagcgtgaccacatggtgctgcttgaatttgtgacagctgctggtatcactcacggcatggatgagctttataagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z