BBa_K174006 1 BBa_K174006 Sac single crossover site for Bacillus subtilis 2009-10-09T11:00:00Z 2015-05-08T01:10:58Z The sequence is taken from 'B. subtilis' 168' sacA gene. When inserted into a 'Bacillus subtilis' integration vector, it provides a single crossover copying the whole plasmid into the bacterial chromosome. Hence this integration biobrick can be ligated with the biobrick that is wanted to be transferred into Bacillus subtilis and inserted into an integration vector such as pmutin4. false false _277_ 0 3942 9 Not in stock false The sequence selected does not contain any restriction site specific to Biobrick standards false The Newcastle 2009 iGEM team BBa_K174006_sequence 1 ttctcatttctgcgcatggcttttagctcaggcagcggctgctgaatcagcttctgtcctgaaagcgtcagctgtctcggcagcgtcatgcagtgaatccagtggcagtcaatggtcggatgggacccttcatcctgatcaggcaccgccatccatgcaaataaaatccgccttccctgatcgtcttcaagtgtttgcggcgcgtaaaaatcaaaaccttgatcaagctccgtaaattcaccatgcttcagttcaggcttgttataatcgaggcggccgacaaaataacctgattgatatacgttctgataacggaaaccgtcagcctcaagcccttgaggcgaaacaatcagcacatccgatcct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z