BBa_I742156 1 BBa_I742156 crtZ native rbs 2007-10-23T11:00:00Z 2015-08-31T04:08:03Z Pantoea ananatis (formerly Erwinia uredovora) DSMZ 30080 (ATCC 19321). Accession: D90087. Native ribosome binding site for crtZ (beta-carotene hydroxylase) from Pantoea ananatis (formerly Erwinia uredovora) DSMZ 30080 (ATCC 19321). Accession: D90087. false false _123_ 0 837 163 Not in stock false A virtual part to be added to the coding sequence blunt (without a scar). false Chris French BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_I742157 1 BBa_I742157 crtZ (beta-carotene hydroxylase) coding sequence 2007-10-23T11:00:00Z 2015-08-31T04:08:03Z Pantoea ananatis (formerly Erwinia uredovora) DSMZ 30080 (ATCC 19321). Accession: D90087. Coding sequence for crtZ (beta-carotene hydroxylase) from Pantoea ananatis (formerly Erwinia uredovora) DSMZ 30080 (ATCC 19321). Accession: D90087. Part of the carotenoid biosynthesis pathway. Converts beta-carotene to the yellow pigment zeaxanthin. false true _123_ 0 837 163 Not in stock false No special considerations. false Chris French annotation1953812 1 crtZ range1953812 1 1 528 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K1747007 1 BBa_K1747007 fatty acid inducible promoter - GFP - crtZ gene - term 2015-08-23T11:00:00Z 2015-08-24T04:36:21Z All sequences were derived from iGEM This is a complete circiut that codes for crtZ gene in a fatty acid dependant manner with a GFP for analysis. false false _2169_ 27803 27803 9 false There is no scar sequence between the promoter and first RBS false Harry Bennett component2437109 1 BBa_K1747004 component2437112 1 BBa_I742156 component2437111 1 BBa_E0040 component2437121 1 BBa_B0015 component2437114 1 BBa_I742157 annotation2437109 1 BBa_K1747004 range2437109 1 1 84 annotation2437112 1 BBa_I742156 range2437112 1 819 834 annotation2437114 1 BBa_I742157 range2437114 1 841 1371 annotation2437121 1 BBa_B0015 range2437121 1 1380 1508 annotation2437111 1 BBa_E0040 range2437111 1 91 810 BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_K817002 1 BBa_K817002 PfadBA 2012-09-17T11:00:00Z 2015-05-08T01:13:28Z de novo synthesis Released HQ 2013 Fatty acid sensitive promoter false false _1075_ 0 13572 9 In stock false N/A false Yi-Te Lee, Chieh-Mei Wang annotation2197686 1 PfadBA range2197686 1 1 72 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_K1747004 1 BBa_K1747004 Fatty acid inducible promoter - no scar - RBS 2015-08-23T11:00:00Z 2015-09-17T06:25:15Z Sequences were acquired from iGEM This is a fatty acid promoter and an RBS without a scar false false _2169_ 27803 27803 9 Not in stock false This intermediate was created with out a scar between the joined sequences false Harry Bennett component2436925 1 BBa_K817002 component2436927 1 BBa_B0034 annotation2436925 1 BBa_K817002 range2436925 1 1 72 annotation2436927 1 BBa_B0034 range2436927 1 73 84 BBa_I742157_sequence 1 atgttgtggatttggaatgccctgatcgttttcgttaccgtgattggcatggaagtgattgctgcactggcacacaaatacatcatgcacggctggggttggggatggcatctttcacatcatgaaccgcgtaaaggtgcgtttgaagttaacgatctttatgccgtggtttttgctgcattatcgatcctgctgatttatctgggcagtacaggaatgtggccgctccagtggattggcgcaggtatgacggcgtatggattactctattttatggtgcacgacgggctggtgcatcaacgttggccattccgctatattccacgcaagggctacctcaaacggttgtatatggcgcaccgtatgcatcacgccgtcaggggcaaagaaggttgtgtttcttttggcttcctctatgcgccgcccctgtcaaaacttcaggcgacgctccgggaaagacatggcgctagagcgggcgctgccagagatgcgcagggcggggaggatgagcccgcatccgggaagtaataa BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1747007_sequence 1 atctggtacgaccagatttgacaatctggtacgaccagatgatactgagcacatcagcaggacgcactgaccaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagctctaccggagaaatttactagatgttgtggatttggaatgccctgatcgttttcgttaccgtgattggcatggaagtgattgctgcactggcacacaaatacatcatgcacggctggggttggggatggcatctttcacatcatgaaccgcgtaaaggtgcgtttgaagttaacgatctttatgccgtggtttttgctgcattatcgatcctgctgatttatctgggcagtacaggaatgtggccgctccagtggattggcgcaggtatgacggcgtatggattactctattttatggtgcacgacgggctggtgcatcaacgttggccattccgctatattccacgcaagggctacctcaaacggttgtatatggcgcaccgtatgcatcacgccgtcaggggcaaagaaggttgtgtttcttttggcttcctctatgcgccgcccctgtcaaaacttcaggcgacgctccgggaaagacatggcgctagagcgggcgctgccagagatgcgcagggcggggaggatgagcccgcatccgggaagtaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_K817002_sequence 1 atctggtacgaccagatttgacaatctggtacgaccagatgatactgagcacatcagcaggacgcactgacc BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_K1747004_sequence 1 atctggtacgaccagatttgacaatctggtacgaccagatgatactgagcacatcagcaggacgcactgaccaaagaggagaaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I742156_sequence 1 ctctaccggagaaatt BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z