BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986785 1 -35 range1986785 1 20 25 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_K175013 1 BBa_K175013 PTet+Lock3c 2009-07-27T11:00:00Z 2015-05-08T01:10:59Z composite part Inducible/Constitutive riboregulator. This part will be in the riboregulator circuit for delay false false _280_ 0 4354 9 Not in stock false --- false Sriram Tiruvadi Krishnan component2013569 1 BBa_R0040 component2013574 1 BBa_J23031 annotation2013569 1 BBa_R0040 range2013569 1 1 54 annotation2013574 1 BBa_J23031 range2013574 1 63 104 BBa_J23031 1 BBa_J23031 [lock3c] 2006-08-02T11:00:00Z 2015-08-31T04:08:39Z Extension of overlapping oligonucleotides key3c false false _52_ 0 483 95 In stock false N/A true John Anderson BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K175013_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaactagaatcacctcttgcttttgggtaagacgaagaggaga BBa_J23031_sequence 1 aactagaatcacctcttgcttttgggtaagacgaagaggaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z