BBa_K1763012 1 BBa_K1763012 Major Spidroin Protein 1 (MaSp1) with Sticky Ends CA 2015-07-26T11:00:00Z 2015-09-18T11:29:29Z This part is derived from the MaSp2 gene found in the spider N. Clavipes. This part contains the core sequence of MaSp1 that has been assembled with a 5'-AGTT-3' overhang on the 5' end of the sequence and 3'-ACAG-5' overhang on the 3' end of the sequence. This part was designed for use with ICA, along with parts BBa_K1763003 and BBa_K1763004 as an efficient method to assemble multiple MaSp sequences together. This setup is to show that this particular set of sticky ends is suitable for ICA. Before using in ICA, this part should be digested with BsaI, a type IIs restriction enzyme, which cuts DNA outside of its recognition site. false false _2185_ 27136 27136 9 false The gene sequence for MaSp2 is particularly GC-rich, which may complicate PCR. false Vinson Lam annotation2433556 1 BsaI recognition site (forward) range2433556 1 1 5 annotation2463778 1 A sticky end range2463778 1 109 112 annotation2463777 1 C sticky end range2463777 1 7 10 annotation2433557 1 BsaI recognition site (reverse) range2433557 1 114 119 annotation2473425 1 MaSp1 Core range2473425 1 11 108 BBa_K1763012_sequence 1 gtctcacgtgggaggagcaggacaaggaggatacggcggattaggatcacaaggagcaggaagaggtggactaggaggacaaggagctggagcagcagcagcagccgcagtttgagacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z