BBa_K177028 1 BBa_K177028 mitochondrial location signal from Cox gene 2009-07-14T11:00:00Z 2015-05-08T01:11:05Z Cox gene mitochondrial location signal from cox gene false false _284_ 0 4696 9 In stock false ... false Kamila Ornoch annotation2011589 1 mito-targeting domain from COX range2011589 1 1 87 BBa_K177028_sequence 1 atgtccgtcctgacgccgctgctgctgcggggcttgacaggctcggcccggcggctcccagtgccgcgcgccaagatccattcgttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z