BBa_K1777002 1 BBa_K1777002 beta-globin intron1 SD with 3 mir-21 targeting sites 2015-09-12T11:00:00Z 2015-09-15T02:05:37Z This part is synthesized de novo. This part has a beta-globin intron1 SD and 3 mir-21 binding domain. This part can be used to build a 6-binding-site mir-21 sponge with another part(BBa_K1777001) with a beta-globin intron 1 SA. This part has a overlap region which overlaps the part(BBa_K1777001), and overlap PCR can be used to connect these two parts. false false _2199_ 25645 25645 9 false We designed overlap region for overlap PCR. The interval sequence is specially designed to avoid higher-level structure of RNA. false Xilin Jiang BBa_K1777002_sequence 1 cagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccacccttagaaaagtggagatcttctcacctagagcttcaagtcaacatcaggacataagctaacttcacatcacacattagtcaacatcaggacataagctataactcaacgacaacatcatcaacatcaggacataagctacataagcaggtgacatgcttaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z