BBa_K1778000 1 BBa_K1778000 CYC1TATA sequence is derived from the TATA box secific sequence of yeast Saccharomyces cerevisiae 2015-09-09T11:00:00Z 2015-09-13T08:40:28Z The sequence is from the plasmid pCM188, and the source of the original source is Saccharomyces cerevisiae. CYC1TATA sequence is derived from the TATA box secific sequence of yeast Saccharomyces cerevisiae which related to snthetic igment CYC1 gene promoter. The sequence act as a supporting role when ribosome in yeast correct identify TRE type compact promoter. In order to make the Tet-on system of prokaryotic origin are better able to play a role in Pichia pastoris,the fragment is very necessary.It is also a major transformation of the project to adapt to the host cells of Pichia pastoris. false false _2200_ 25918 25918 9 true In the use of the part in Pichia pastoris, we need to consider whether the sequence is able to achieve the desired purpose.Fortunately, we have found evidence in the literature that this is a key part of the Tet-on system in yeast. false Lehua Jia BBa_K1778000_sequence 1 gcatgcatgtgctctgtatgtatataaaactcttgttttcttcttttctctaaatattctttccttatacattaggtcctttgtagcataaattactatacttctatagacacgcaaacacaaatacacacactaaattaccggatcaattcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z