BBa_K1780027 1 BBa_K1780027 pL + P left promoters 2015-09-17T11:00:00Z 2015-09-18T05:43:16Z Lambdaphage and Mycobacteriophage The pL promoter from Lambdaphage and P left promoter from Mycobacteriophage are arrange in series such that they can work parallel with each other. This part can be use to express the gene in both E.coli and M.smegmatis in shuttle vector. false false _2205_ 26340 26340 9 false No false Yash Jawale component2474435 1 BBa_K1780026 component2474434 1 BBa_K1780025 annotation2474434 1 BBa_K1780025 range2474434 1 1 75 annotation2474435 1 BBa_K1780026 range2474435 1 84 172 BBa_K1780025 1 BBa_K1780025 pL Promoter 2015-09-17T11:00:00Z 2015-09-18T05:33:21Z Lambdaphage pL promoter from Lambdaphage false false _2205_ 26340 26340 9 false No false Yash Jawale BBa_K1780026 1 BBa_K1780026 P left promoter 2015-09-17T11:00:00Z 2015-09-18T05:37:08Z Mycobacteriophage P left promoter from Mycobacteriophage false false _2205_ 26340 26340 9 false No false Yash Jawale BBa_K1780027_sequence 1 caccaatttgcgattagggcttgacagccacccggccagtagtgcattcttgtgtcaccgcagcagcaaggcggttactagaggcggtgataaattatctctggcggtgttgacataaataccactggcggtgatactgagcacatcagcaggacgcactgaccaccatgaa BBa_K1780026_sequence 1 gcggtgataaattatctctggcggtgttgacataaataccactggcggtgatactgagcacatcagcaggacgcactgaccaccatgaa BBa_K1780025_sequence 1 caccaatttgcgattagggcttgacagccacccggccagtagtgcattcttgtgtcaccgcagcagcaaggcggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z