BBa_K1787000 1 Cys-Thr High Cys-Thr protein 2015-09-17T11:00:00Z 2015-09-18T12:28:10Z The DNA sequence encoding for the protein of interest was engineered in a way so as to have a higher Cysteine and Threonine concentration. It does not exist in Nature. It was introduced into BBa_K1321338 (containing a T7 promoter with a RBS). This part contains a T7 promoter with a Ribosome Binding Site next to it; additionally, it encodes for a protein which has a 26% composition of Cysteine and 20% composition of Threonine. We have preliminary data that suggests that after isolation, run through an SDS-PAGE, and silver staining, this protein shows a different colouration than that of the normal silver stained protein gels. false false _2212_ 25741 25741 9 false In order for our sequence to be synthesized, we had to intercalate non-polar amino acids between the cysteines and the threonines; these two being of a polar nature. false Eduardo R. Serratos annotation2469549 1 High in Cys-Thr Protein range2469549 1 51 629 annotation2469547 1 BBa_K1321338 range2469547 1 1 43 annotation2469548 1 Scar (PstI/XbaI) range2469548 1 45 50 BBa_K1787000_sequence 1 taatacgactcactatagggagatactagagaaagaggagaaatactagaggcattctaggatcaggaggacagctatgtgtactttttgcacctgtccatgtacaatgtgcacgatttgtaccctatgtacggcttgcactgtttgcacaggttgtggctgcctcgtaatctggtgttgcttcgggatgttaatcacgacctggggagctgtgctggcctgtgggatgttaatattttgcctagcatgcgtatgtgccatgtgtctcacctgcgctactggtacccctacagccacgttgtgtggctgccccacggcatgtctttgcggaaccccaacagcgtgcctatgtgggaccccgtgcttctgtatgacgctgtgttgcttctgtccttgcctcacgtggtgtggcactgcatgcatcacatggaccgttacgatttgcgtctgtaccatatgcgctacatgtactgtatgttgcgtgggtactgctgttaccctttgtattatgacgttttggcctggctgcgccgtgacactcatatgttgcttccccacaatggggctggtagcatgcacgccagcgtgtcaccatcaccatcaccattagtagtagctcgctagaatgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z