BBa_K1791005 1 BBa_K1791005 T7 promoter fused with a theophylline inducible ribozyme (aptazyme) 2015-09-22T11:00:00Z 2015-09-22T11:17:58Z Win, M.N., Smolke C.D. 2007 and BBa_I719005 This part was developed in order to increase the sequence space flexibility in dsRNA generated using BBa_K1791001 and BBa_K1791002 false false _2216_ 17031 17031 9 false by changing the T7 promoter sequence (BBa_I719005) slightly after the GGG trinulceotide we get an increase in the potential for generating RNA with our composite parts BBa_K1791001 and BBa_K1791002. false Graeme Glaister BBa_K1791005_sequence 1 taatacgactcactatagggagaaaacaaacaaagctgtcaccggatgtgctttccggtctgatgagtccgtgttgctgataccagcatcgtcttgatgcccttggcagcagtggacgaggacgaaacagcaaaaagaaaaataaaaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z