BBa_K1792005 1 BBa_K1792005 Nuclease - secreted with Cterm 6xHis tag 2015-09-16T11:00:00Z 2015-09-17T02:27:52Z This is a genomic sequence of Nuclease from Staphylococcus aureus. Found in the UniprotKB database: P00644 (NUC_STAAU). The first 64 amino acids have been removed (not necessary for function). It has a functional bacterial N-terminal secretion tag that is 19 amino acids in length. This part exists as a basic part only. For a working part see the composite part: BBa_K1792004 Nuclease from Staphylococcus aureus. This nuclease is secreted due to a bacterial N-terminal export tag. The nuclease contains a C-terminal 6xHis tag for possible purification and concentration. This part is the same as BBa_K729004 with the addition of the his-tag. Endonucleolytic cleavage to nucleoside 3'-phosphates and 3'-phosphooligonucleotides (Enzyme that catalyzes the hydrolysis of both DNA and RNA at the 5' position of the phosphodiester bond.) false false _2217_ 28641 28641 9 false The first 64 amino acids have been removed (not necessary for function). It has a functional bacterial N-terminal secretion tag that is 19 amino acids in length. false Brian Dempsey BBa_K1792005_sequence 1 atgaaaaaaatttggttagcgctggcgggtttggtcctggccttttctgccagcgcgcagacggacaatggagttaaccgtagtgggtcagaagatccgacagtgtattcagcgaccagcactaaaaaacttcacaaagaaccggcaaccctgattaaagccatcgacggcgacacagtgaaattgatgtataaaggtcagccgatgaccttccgcctcctgctggtggataccccggaaaccaaacatccgaagaagggtgtcgagaaatacggtccggaagccagcgcctttacgaagaaaatggtggaaaatgcgaagaaaattgaagtagaatttgataaaggtcagcgcacggacaaatacgggcgtggtctggcctatatttacgcggacggcaaaatggttaacgaagccttggttcgtcagggtctggcaaaagtggcatatgtttacaaaccgaataatacccacgaacaacacctgcgtaaaagtgaagcgcaggcaaaaaaggaaaaattaaacatttggagcgaagataatgccgactctggccaacatcaccaccaccaccat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z