BBa_K1796113 1 BBa_K1796113 two Restriction Enzyme cutting sites(BamHI and HindIII) 2015-09-16T11:00:00Z 2015-09-17T08:43:10Z We found equence in reference and connected them together. this part is a series connection of wo Restriction Enzyme cutting sites,which is BamHI and HindIII. false false _2221_ 23498 23498 9 false When you put it between RBS and double terminator, make it convenient when we assemble expression vector. false Tang Yulong annotation2466021 1 BamHI range2466021 1 7 12 annotation2466024 1 HindIII range2466024 1 19 24 BBa_K1796113_sequence 1 gacgtcggatccgacgtcaagcttgacgtc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z