BBa_K1799004 1 BBa_K1799004 LsrC (wild type) 2015-08-06T11:00:00Z 2015-08-07T12:32:25Z This part was synthesized from E. coli genomic data retrieved via EcoGene: http://www.ecogene.org/gene/EG13807 Gene for the C subunit of the LsrACDB transporter, present in E. coli on the LsrACDBFG operon. The C subunit is a permease protein in the transporter, which actively brings autoinducer 2 (AI-2) into the cell. false false _2224_ 19613 19613 9 false The portion of the LsrACDBFG operon that codes for the AI-2 transporter consists of four open reading frames, which code for A, C, D, and B, respectively. Three of these ORFs overlap with one another: C overlaps with A, and its RBS is contained within the A subunit ORF, and D overlaps with C (although to a lesser extent), and its RBS is contained within the C subunit ORF. From a modularization standpoint, this creates an inefficiency because the wild type ORFs of the A and C subunits both contain functional RBSs, and in the case of the A subunit ORF, an ATG 4bp downstream. To reduce this inefficiency, we have created versions of each subunit ORF that are optimized for modularization. Further explanation is available in the descriptions of those parts. false Miranda Halle BBa_K1799004_sequence 1 atgctgaagtttattcagaacaaccgtgaaatcacggcactgctggcggtggtgctgctgtttgtattacccggttttctcgaccgccagtatttaagtgtgcaaacgctgaccatggtttatagcagcgcgcaaatcctgatcctgctggcaatgggcgcgacgctggtaatgcttacgcgcaatattgatgtttcagtgggttcgattaccggaatgtgcgcggtgctgttggggatgttactgaacgcaggatattcactacctgttgcttgtgtcgcgactttactgcttggtttgctcgcgggatttttcaacggtgtcctggtcgcgtggctaaagatccctgccattgttgccacccttggcacgttagggttgtacagaggcatcatgttgctgtggactggcggcaaatggattgaagggttacccgccgaactgaaacagctctccgccccgctgctgcttggcgtttcagcaattggttggttgacgataattctggtggcatttatggcctggctgctggcaaagacggcgtttggacgcagtttttatgccacgggcgataatttacagggcgctcgtcaactgggcgttcgtactgaagccattcgcattgtggcattttcgttgaacggctgcatggcggcactggcgggaattgtgtttgcttcgcagattggttttatccccaaccagaccggtaccgggctggagatgaaagcaattgcagcctgcgtgctgggcggcattagtttgctcggtggttccggtgcgatcattggtgcggtactcggcgcatggttcctgacgcagatcgatagcgtactggtgctgttgcgcattccggcatggtggaatgattttatcgcgggtctggttctgctggcggtgctggtgtttgatggacgcctgcgttgtgcgctggaacgtaatctacggcggcaaaaatatgcccgctttatgacgccaccgccatccgttaaacccgcttcgtcaggtaaaaaacgggaggccgcataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z