BBa_K1806004 1 BBa_K1806004 T7+ ibPB RNA Thermometer + pelB + MCS + 6xHis 2015-09-16T11:00:00Z 2015-09-20T11:13:33Z This is a composite part formed up of distinct parts from distinct origins. The part is to act as a backbone for the T7+ibPB RNA Thermometer+pelB+6xHis system. The MCS(Multiple Cloning Site) as the ligation region for the parts to be integrated into the system. The part that is added to the backbone will be translated in the presence of higher temperatures. The pelB signal peptide is present for the produced protein to be carried out of the cell. The 6xHis is for protein analysis. false false _2231_ 11155 11153 9 true none false İBRAHİM YASİR ORHAN BBa_K1806004_sequence 1 gagatctcgatcccgcgaaattaatacgactcactataggcctgtagaaataatttccctaaggccgcctggcgcggcctgacatctccatgctcgccgtcagggagcatatgcgaatcttcggatttgcaggtacttactcgcttcttagaaggagaaatgactatgaaatacctgctgccgaccgctgctgctggtctgctgctcctcgctgcccagccggcgatggccatggatatcggaattaattcggatccgagctccgtcgacaagcttctcgagcaccatcaccaccaccactgagatccggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z