BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_J23119 1 BBa_J23119 constitutive promoter family member 2006-08-23T11:00:00Z 2015-08-31T04:08:40Z Overlap extension of synthetic oligonucleotides Released HQ 2013 Later false true _52_ 0 483 95 In stock false N/A true John Anderson BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K1809007 1 BBa_K1809007 Const. Promoter-RBS-MaAFP-DT 2015-08-02T11:00:00Z 2015-08-03T04:05:53Z Composite of parts BBa_J23119 and BBa_K1809024. This part contains the constitutive promoter BBa_J23119, an RBS, Macrozarces americanus antifreeze protein (MaAFP), and a double terminator. It produces a high level of expression of the antifreeze protein. false false _2234_ 26152 26152 9 false Used a strong promoter to produce high levels of expression of MaAFP. false Edward Dring component2434104 1 BBa_B0012 component2434099 1 BBa_B0034 component2434097 1 BBa_J23119 component2434102 1 BBa_B0010 component2434101 1 BBa_K1809006 annotation2434099 1 BBa_B0034 range2434099 1 44 55 annotation2434101 1 BBa_K1809006 range2434101 1 62 325 annotation2434104 1 BBa_B0012 range2434104 1 422 462 annotation2434097 1 BBa_J23119 range2434097 1 1 35 annotation2434102 1 BBa_B0010 range2434102 1 334 413 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1809006 1 BBa_K1809006 MaAFP 2015-08-02T11:00:00Z 2016-01-27T10:33:14Z Taken from the ocean pout Macrozarces americanus. Pubmed ID: 3840475 Antifreeze proteins (AFPs) are molecules with the unique property of binding and shaping ice crystals, preventing their growth into relatively large cell-lysing structures (Davies and Sykes 1997). They exhibit a property known as thermal hysteresis, whereby their activity decreases the freezing point of water without changing the melting point. This property allows organisms which produce AFPs to survive colder conditions. Additionally, AFPs have shown biolfilm inhibbiting properties, potetnially giving them uses in medical applications. false false _2234_ 4206 26152 9 false Codon optimized the sequence for E. coli and to minimize repetitive sequences; removed illegal restriction sites. false Edward Dring annotation2433990 1 MaAFP range2433990 1 1 264 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_K1809007_sequence 1 ttgacagctagctcagtcctaggtataatgctagctactagagaaagaggagaaatactagatgaaaagcgtgattcttacgggcctgctgtttgtgttactgtgtgttgatcatatgaccgccagccagtccgtcgtcgctacgcagctgatcccaatcaatactgccctgacgcccgcgatgatggaaggaaaggtgaccaatccaattgggattccgttcgctgaaatgtcacagatcgtgggcaaacaagtgaacaccccggtggcgaaaggtcagacgctgatgcccaacatggtaaaaacttatgttgccgggaaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23119_sequence 1 ttgacagctagctcagtcctaggtataatgctagc BBa_K1809006_sequence 1 atgaaaagcgtgattcttacgggcctgctgtttgtgttactgtgtgttgatcatatgaccgccagccagtccgtcgtcgctacgcagctgatcccaatcaatactgccctgacgcccgcgatgatggaaggaaaggtgaccaatccaattgggattccgttcgctgaaatgtcacagatcgtgggcaaacaagtgaacaccccggtggcgaaaggtcagacgctgatgcccaacatggtaaaaacttatgttgccgggaaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z