BBa_K1828999 1 BBa_K1828999 nlmAB promoter 2015-09-02T11:00:00Z 2015-09-03T09:35:09Z It comes from genomic sequence of Streptococcus mutans nlmAB promoter is a natural promoter found in Streptococcus mutans. This promoter is upregulated by addition of Competence Stimulating Peptide (CSP) false false _2254_ 20031 20031 9 false There are no special design considerations false Altynay Abdirakhmanova BBa_K1828999_sequence 1 aaattagctggtaatgatagtttcagaacatcaaaaatgaccgtttaagacaaaatagctaccatttaggatattttgctctattttgaaaataaattgttatactaaagatgttggttgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z