BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986787 1 -10 range1986787 1 43 48 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_S05279 1 BBa_S05279 K1846002:B0010 2015-08-27T11:00:00Z 2015-08-28T03:52:59Z false false _9_ 27305 27305 9 false false Barbara Steijl annotation2439261 1 BBa_K1846002 range2439261 1 1 585 annotation2439263 1 stem_loop range2439263 1 605 648 annotation2439262 1 BBa_B0010 range2439262 1 594 673 BBa_S05278 1 BBa_S05278 B0034:K1846002 2015-08-27T11:00:00Z 2015-08-28T03:51:09Z false false _9_ 27305 27305 9 false false Barbara Steijl annotation2439242 1 BBa_B0034 range2439242 1 1 12 annotation2439243 1 BBa_K1846002 range2439243 1 19 603 annotation2439241 1 conserved range2439241 1 5 8 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_S05276 1 BBa_S05276 R0040:B0034 2015-08-27T11:00:00Z 2015-08-28T03:23:28Z false false _9_ 27305 27305 9 false false Barbara Steijl annotation2439172 1 TetR 1 range2439172 1 1 19 annotation2439175 1 -10 range2439175 1 43 48 annotation2439171 1 BBa_R0040 range2439171 1 1 54 annotation2439177 1 BBa_B0034 range2439177 1 63 74 annotation2439176 1 conserved range2439176 1 67 70 annotation2439174 1 TetR 2 range2439174 1 26 44 annotation2439173 1 -35 range2439173 1 20 25 BBa_K1846001 1 tfa+ Bacteriophage lambda tail fibre assembly protein circuit 2015-08-25T11:00:00Z 2015-09-20T01:26:15Z ... The tfa (tail fibre assembly) protein of bacteriophage Lambda assists in the assembly of the stf (short tail fibre) protein into a functional tail fibre. This part provides the gene sequence for tfa, together with a TetR repressible promoter (TetO, available separately as BioBrick part BBa_R0040), ribosome binding site (available separately as part BBa_B0034) and an rrNB T1 terminator (available separately as BioBrick part BBa_B0010). false false _2272_ 24377 27305 9 false ... false Luba Prout component2439269 1 BBa_R0040 component2439275 1 BBa_B0034 component2439277 1 BBa_S05278 component2439278 1 BBa_K1846002 component2439272 1 BBa_S05276 component2439280 1 BBa_S05279 component2439281 1 BBa_B0010 component2439274 1 BBa_B0034 component2439264 1 BBa_R0040 component2439279 1 BBa_K1846002 annotation2439269 1 BBa_R0040 range2439269 1 55 80 annotation2439281 1 BBa_B0010 range2439281 1 721 800 annotation2439274 1 BBa_B0034 range2439274 1 81 92 annotation2439280 1 BBa_S05279 range2439280 1 684 720 annotation2439275 1 BBa_B0034 range2439275 1 93 98 annotation2439264 1 BBa_R0040 range2439264 1 1 54 annotation2439279 1 BBa_K1846002 range2439279 1 684 720 annotation2439278 1 BBa_K1846002 range2439278 1 99 683 annotation2439272 1 BBa_S05276 range2439272 1 55 80 annotation2439277 1 BBa_S05278 range2439277 1 93 98 BBa_K1846002 1 tfa Bacteriophage lambda tail fibre assembly (tfa) protein 2015-08-25T11:00:00Z 2015-09-20T01:20:28Z The sequence has been adapted from the genomic sequence of bacteriophage Lambda. The tfa (tail fibre assembly) protein of bacteriophage Lambda assists in the assembly of the stf (short tail fibre) protein into a functional tail fibre. false false _2272_ 24377 27305 9 false Sequence was optimised to remove illegal restriction sites. false Luba Prout BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_S05278_sequence 1 atacaa BBa_K1846001_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacgatgtcaaagaatacaagcattgactaaagaggagaaaatacaaatggcgttccgtatgagtgaacaaccacgtaccattaaaatttataatctgctggccggtactaatgaatttattggtgaaggtgacgcatatattccgcctcataccggcctgcctgcaaacagtaccgatattgcaccgccagatattccggctggctttgtggctgttttcaacagtgatgaggcatcgtggcatctcgttgaagaccatcgtggtaaaaccgtctatgacgtggcttccggcgacgcgttatttatttctgaactcggtccgttaccggaaaattttacctggttatcgccgggtggggaatatcagaagtggaacggcacagcctgggtgaaggatacggaagcagaaaaactgttccgtatccgtgaggcggaagaaacaaaaaaaagcctgatgcaagtagccagtgagcatattgcgccgcttcaggatgcggcggatctggaaattgcaacgaaggaagaaacctcgttgctggaagcctggaagaagtatcgtgtgttgctgaaccgtgttgatacatcaactgcacctgatattgagtggcctgctgtccctgttatggagtaataacgctgatactgatagtgctagtagtgtagatcgcccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_S05279_sequence 1 taacgctgatactgatagtgctagtagtgtagatcgc BBa_S05276_sequence 1 gatgtcaaagaatacaagcattgact BBa_K1846002_sequence 1 atggcgttccgtatgagtgaacaaccacgtaccattaaaatttataatctgctggccggtactaatgaatttattggtgaaggtgacgcatatattccgcctcataccggcctgcctgcaaacagtaccgatattgcaccgccagatattccggctggctttgtggctgttttcaacagtgatgaggcatcgtggcatctcgttgaagaccatcgtggtaaaaccgtctatgacgtggcttccggcgacgcgttatttatttctgaactcggtccgttaccggaaaattttacctggttatcgccgggtggggaatatcagaagtggaacggcacagcctgggtgaaggatacggaagcagaaaaactgttccgtatccgtgaggcggaagaaacaaaaaaaagcctgatgcaagtagccagtgagcatattgcgccgcttcaggatgcggcggatctggaaattgcaacgaaggaagaaacctcgttgctggaagcctggaagaagtatcgtgtgttgctgaaccgtgttgatacatcaactgcacctgatattgagtggcctgctgtccctgttatggagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z