BBa_C0040 1 tetR tetracycline repressor from transposon Tn10 (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999) Released HQ 2013 Coding region for the TetR protein without the Ribosome Binding Site. Modified with an LVA tail for rapid degradation of the protein and faster fall time for the emission. TetR binds to the pTet regulator (BBa_R0040). aTc (anhydrotetracycline) binds to TetR and inhibits its operation.</P> false true _1_ 0 24 7 In stock false References (unparsed) here: <p>Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). </P> <p> Lutz R, Bujard H., Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. PMID: 9092630 </p> <P> References (unparsed) here: <p>Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). </P> <p> Lutz R, Bujard H., Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. PMID: 9092630 </p> <P>BBa_C0040 TetR Protein is based on the TetR sequence from Elowitz's repressilator. It has been modified to include a rapid degradation LVA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA. <P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman. annotation23330 1 SsrA range23330 1 621 654 annotation2213989 1 Help:Barcodes range2213989 1 661 685 annotation23329 1 tetR range23329 1 4 620 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K1846001 1 tfa+ Bacteriophage lambda tail fibre assembly protein circuit 2015-08-25T11:00:00Z 2015-09-20T01:26:15Z ... The tfa (tail fibre assembly) protein of bacteriophage Lambda assists in the assembly of the stf (short tail fibre) protein into a functional tail fibre. This part provides the gene sequence for tfa, together with a TetR repressible promoter (TetO, available separately as BioBrick part BBa_R0040), ribosome binding site (available separately as part BBa_B0034) and an rrNB T1 terminator (available separately as BioBrick part BBa_B0010). false false _2272_ 24377 27305 9 false ... false Luba Prout component2439269 1 BBa_R0040 component2439277 1 BBa_S05278 component2439279 1 BBa_K1846002 component2439275 1 BBa_B0034 component2439272 1 BBa_S05276 component2439274 1 BBa_B0034 component2439278 1 BBa_K1846002 component2439281 1 BBa_B0010 component2439264 1 BBa_R0040 component2439280 1 BBa_S05279 annotation2439281 1 BBa_B0010 range2439281 1 721 800 annotation2439264 1 BBa_R0040 range2439264 1 1 54 annotation2439274 1 BBa_B0034 range2439274 1 81 92 annotation2439278 1 BBa_K1846002 range2439278 1 99 683 annotation2439279 1 BBa_K1846002 range2439279 1 684 720 annotation2439269 1 BBa_R0040 range2439269 1 55 80 annotation2439275 1 BBa_B0034 range2439275 1 93 98 annotation2439277 1 BBa_S05278 range2439277 1 93 98 annotation2439272 1 BBa_S05276 range2439272 1 55 80 annotation2439280 1 BBa_S05279 range2439280 1 684 720 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1846002 1 tfa Bacteriophage lambda tail fibre assembly (tfa) protein 2015-08-25T11:00:00Z 2015-09-20T01:20:28Z The sequence has been adapted from the genomic sequence of bacteriophage Lambda. The tfa (tail fibre assembly) protein of bacteriophage Lambda assists in the assembly of the stf (short tail fibre) protein into a functional tail fibre. false false _2272_ 24377 27305 9 false Sequence was optimised to remove illegal restriction sites. false Luba Prout BBa_S05276 1 BBa_S05276 R0040:B0034 2015-08-27T11:00:00Z 2015-08-28T03:23:28Z false false _9_ 27305 27305 9 false false Barbara Steijl annotation2439172 1 TetR 1 range2439172 1 1 19 annotation2439175 1 -10 range2439175 1 43 48 annotation2439176 1 conserved range2439176 1 67 70 annotation2439174 1 TetR 2 range2439174 1 26 44 annotation2439173 1 -35 range2439173 1 20 25 annotation2439171 1 BBa_R0040 range2439171 1 1 54 annotation2439177 1 BBa_B0034 range2439177 1 63 74 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986785 1 -35 range1986785 1 20 25 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_I14033 1 Cat P(Cat) 2004-08-03T11:00:00Z 2015-08-31T04:07:37Z Plasmid pACYC184 Released HQ 2013 Constitutive Promoter, Medium Transcription false false _4_ 0 171 7 In stock false true Vikram Vijayan, Allen Hsu, Lawrence Fomundam annotation1026172 1 -35 range1026172 1 4 9 annotation1026174 1 P(Cat) range1026174 1 1 38 annotation1026173 1 -10 range1026173 1 27 32 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_P0140 1 BBa_P0140 PoPS -> TetR [S0163] 2004-04-24T11:00:00Z 2015-05-08T01:14:10Z Released HQ 2013 Protein generator converting TIPS to the protein TetR. Used as the input section for Quad Part Inverter Q01140. false false _1_ 0 24 7 In stock false true Randy Rettberg component944448 1 BBa_B0010 component944442 1 BBa_C0040 component944432 1 BBa_B0031 component944458 1 BBa_B0012 annotation944458 1 BBa_B0012 range944458 1 802 842 annotation944448 1 BBa_B0010 range944448 1 714 793 annotation944432 1 BBa_B0031 range944432 1 1 14 annotation944442 1 BBa_C0040 range944442 1 21 680 BBa_S05278 1 BBa_S05278 B0034:K1846002 2015-08-27T11:00:00Z 2015-08-28T03:51:09Z false false _9_ 27305 27305 9 false false Barbara Steijl annotation2439242 1 BBa_B0034 range2439242 1 1 12 annotation2439243 1 BBa_K1846002 range2439243 1 19 603 annotation2439241 1 conserved range2439241 1 5 8 BBa_B0031 1 BBa_B0031 RBS.2 (weak) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Medium RBS based on Ron Weiss thesis. Strength considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false <P> <P>Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-1&quot; in figure 4-14 of thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Cho</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23316 1 conserved range23316 1 7 10 BBa_S05279 1 BBa_S05279 K1846002:B0010 2015-08-27T11:00:00Z 2015-08-28T03:52:59Z false false _9_ 27305 27305 9 false false Barbara Steijl annotation2439262 1 BBa_B0010 range2439262 1 594 673 annotation2439261 1 BBa_K1846002 range2439261 1 1 585 annotation2439263 1 stem_loop range2439263 1 605 648 BBa_K1846007 1 TetR+tfa+ Bacteriophage lambda tail fibre assembly (tfa) under TetR regulation 2015-09-16T11:00:00Z 2015-09-20T01:47:20Z ... A circuit controlling the production of the tail fibre assembly (tfa) protein of bacteriophage lambda. The tfa gene operates under a TetR repressible promoter, while a second circuit produces TetR (tetracycline repressor) under control of a P(Cat) promoter. false false _2272_ 24377 27305 9 true ... false Luba Prout component2465868 1 BBa_K1846001 component2465848 1 BBa_P0140 component2465835 1 BBa_I14033 annotation2465835 1 BBa_I14033 range2465835 1 1 38 annotation2465868 1 BBa_K1846001 range2465868 1 897 1696 annotation2465848 1 BBa_P0140 range2465848 1 47 888 BBa_B0034_sequence 1 aaagaggagaaa BBa_K1846001_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacgatgtcaaagaatacaagcattgactaaagaggagaaaatacaaatggcgttccgtatgagtgaacaaccacgtaccattaaaatttataatctgctggccggtactaatgaatttattggtgaaggtgacgcatatattccgcctcataccggcctgcctgcaaacagtaccgatattgcaccgccagatattccggctggctttgtggctgttttcaacagtgatgaggcatcgtggcatctcgttgaagaccatcgtggtaaaaccgtctatgacgtggcttccggcgacgcgttatttatttctgaactcggtccgttaccggaaaattttacctggttatcgccgggtggggaatatcagaagtggaacggcacagcctgggtgaaggatacggaagcagaaaaactgttccgtatccgtgaggcggaagaaacaaaaaaaagcctgatgcaagtagccagtgagcatattgcgccgcttcaggatgcggcggatctggaaattgcaacgaaggaagaaacctcgttgctggaagcctggaagaagtatcgtgtgttgctgaaccgtgttgatacatcaactgcacctgatattgagtggcctgctgtccctgttatggagtaataacgctgatactgatagtgctagtagtgtagatcgcccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_P0140_sequence 1 tcacacaggaaacctactagatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I14033_sequence 1 ggcacgtaagaggttccaactttcaccataatgaaaca BBa_K1846007_sequence 1 ggcacgtaagaggttccaactttcaccataatgaaacatactagagtcacacaggaaacctactagatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacgatgtcaaagaatacaagcattgactaaagaggagaaaatacaaatggcgttccgtatgagtgaacaaccacgtaccattaaaatttataatctgctggccggtactaatgaatttattggtgaaggtgacgcatatattccgcctcataccggcctgcctgcaaacagtaccgatattgcaccgccagatattccggctggctttgtggctgttttcaacagtgatgaggcatcgtggcatctcgttgaagaccatcgtggtaaaaccgtctatgacgtggcttccggcgacgcgttatttatttctgaactcggtccgttaccggaaaattttacctggttatcgccgggtggggaatatcagaagtggaacggcacagcctgggtgaaggatacggaagcagaaaaactgttccgtatccgtgaggcggaagaaacaaaaaaaagcctgatgcaagtagccagtgagcatattgcgccgcttcaggatgcggcggatctggaaattgcaacgaaggaagaaacctcgttgctggaagcctggaagaagtatcgtgtgttgctgaaccgtgttgatacatcaactgcacctgatattgagtggcctgctgtccctgttatggagtaataacgctgatactgatagtgctagtagtgtagatcgcccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_S05276_sequence 1 gatgtcaaagaatacaagcattgact BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_S05278_sequence 1 atacaa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_S05279_sequence 1 taacgctgatactgatagtgctagtagtgtagatcgc BBa_C0040_sequence 1 atgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac BBa_B0031_sequence 1 tcacacaggaaacc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1846002_sequence 1 atggcgttccgtatgagtgaacaaccacgtaccattaaaatttataatctgctggccggtactaatgaatttattggtgaaggtgacgcatatattccgcctcataccggcctgcctgcaaacagtaccgatattgcaccgccagatattccggctggctttgtggctgttttcaacagtgatgaggcatcgtggcatctcgttgaagaccatcgtggtaaaaccgtctatgacgtggcttccggcgacgcgttatttatttctgaactcggtccgttaccggaaaattttacctggttatcgccgggtggggaatatcagaagtggaacggcacagcctgggtgaaggatacggaagcagaaaaactgttccgtatccgtgaggcggaagaaacaaaaaaaagcctgatgcaagtagccagtgagcatattgcgccgcttcaggatgcggcggatctggaaattgcaacgaaggaagaaacctcgttgctggaagcctggaagaagtatcgtgtgttgctgaaccgtgttgatacatcaactgcacctgatattgagtggcctgctgtccctgttatggagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z