BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_K185048 1 BBa_K185048 RelB antitoxin 2009-10-15T11:00:00Z 2015-05-08T01:11:07Z None None false false _318_ 0 3967 9 Not in stock false None false Alex Jiang annotation2046599 1 start range2046599 1 1 3 annotation2046800 1 stop range2046800 1 256 258 annotation2046600 1 cds range2046600 1 1 240 annotation2046993 1 His tag range2046993 1 241 255 BBa_K185028 1 BBa_K185028 RelB+Double Terminator 2009-10-15T11:00:00Z 2015-05-08T01:11:06Z None None false false _318_ 0 3967 9 It's complicated false None false Shikun Zhao component2048284 1 BBa_B0012 component2048282 1 BBa_B0010 component2048281 1 BBa_K185048 annotation2048284 1 BBa_B0012 range2048284 1 355 395 annotation2048281 1 BBa_K185048 range2048281 1 1 258 annotation2048282 1 BBa_B0010 range2048282 1 267 346 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K185028_sequence 1 atgggtagcattaacctgcgtattgacgatgaacttaaagcgcgttcttacgccgcgcttgaaaaaatgggtgtaactccttctgaagcgcttcgtctcatgctcgagtatatcgctgacaatgaacgcttgccgttcaaacagacactcctgagtgatgaagatgctgaacttgtggagatagtgaaagaacggcttcgtaatcctaagccagtacgtgtgacgctggatgaactccatcatcatcatcatcactgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K185048_sequence 1 atgggtagcattaacctgcgtattgacgatgaacttaaagcgcgttcttacgccgcgcttgaaaaaatgggtgtaactccttctgaagcgcttcgtctcatgctcgagtatatcgctgacaatgaacgcttgccgttcaaacagacactcctgagtgatgaagatgctgaacttgtggagatagtgaaagaacggcttcgtaatcctaagccagtacgtgtgacgctggatgaactccatcatcatcatcatcactga BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z