BBa_K1860700 1 BBa_K1860700 miRNA2911 2015-09-12T11:00:00Z 2015-09-13T09:11:06Z in progress: Enter the source of this part. For example, does it come from some genomic sequence? in progress: Enter a long description of the part so that users of your part know what it is, what it does, and how to use it in their projects. false false _2288_ 26797 26797 9 false in progress: Enter any design considerations you had to deal with during the detailed design of the sequence. false Maurice Langhinrichs, Vincent Fortuin, Henning Jacobsen annotation2453192 1 miRNA2911 range2453192 1 1 20 BBa_K1860700_sequence 1 ggccgggggacggactggga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z