BBa_K1860701 1 BBa_K1860701 GroEL promoter 2015-09-12T11:00:00Z 2015-09-13T09:25:58Z in progress: Enter the source of this part. For example, does it come from some genomic sequence? in progress: Enter a long description of the part so that users of your part know what it is, what it does, and how to use it in their projects. false false _2288_ 26797 26797 9 false in progress: Enter any design considerations you had to deal with during the detailed design of the sequence. false Maurice Langhinrichs, Vincent Fortuin, Henning Jacobsen annotation2453198 1 Pribnow Box range2453198 1 48 52 annotation2453199 1 Ribosome Binding Site range2453199 1 41 47 annotation2453197 1 GroEL Promoter range2453197 1 1 52 BBa_K1860701_sequence 1 cagtttcccccttgaaggggcgaagcctcatccccatttgaaggagatatta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z