BBa_K187003 1 BBa_K187003 Sigma 70 1% promoter in pAB BioBytes plasmid 2009-10-15T11:00:00Z 2015-05-08T01:11:07Z 1% promoter was modified from Anderson collection of promoters, part BBa_J23113 pAB was derived from pUC19 The 1% promoter produced ~1% of the expression level from a consensus promoter. The pAB plasmid adapts the promoter for assembly with other parts using the BioBytes assembly system. See the BioBytes RFC for details on this method. false true _286_ 0 4048 9 It's complicated false The 1% promoter produced ~1% of the expression level from a consensus promoter. The pAB plasmid adapts the promoter for assembly with other parts using the BioBytes assembly system. See the BioBytes RFC for details on this method. false Team BioBytes annotation2051600 1 PstI range2051600 1 47 52 annotation2051597 1 -10 range2051597 1 40 45 annotation2051598 1 -35 range2051598 1 16 21 annotation2051599 1 Xba range2051599 1 10 15 BBa_K187003_sequence 1 tgaggaggttctagactgatggctaggtcagtgctagggattatgcctgcagtg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z