BBa_K187005 1 BBa_K187005 Sigma 70 25% promoter in pAB, BioBytes plasmid 2009-10-15T11:00:00Z 2015-05-08T01:11:07Z The 25% promoter was modified from Anderson collection of promoters, part BBa_J23105. Plasmid pAB was derived from pUC19, and is entered as part BBa_K187000. The 25% promoter produces ~25% of the expression level from a consensus promoter. The pAB plasmid (part BBa_K187000) adapts the promoter for assembly with other parts using the BioBytes assembly system. See the BioBytes BBF RFC for details on this method. false true _286_ 0 4048 9 It's complicated false The 25% promoter produces ~25% of the expression level from a consensus promoter. The pAB plasmid adapts the promoter for assembly with other parts using the BioBytes assembly system. See the BioBytes RFC for details on this method. The Biobytes assembly method requires that the DNA fragments to be assembled have long sticky ends of particular sequence. DNA fragments with these sticky ends can be prepared using genes in pBA or pAB as a template. The structure of pAB and pBA will result in a ribosome binding site being included 7bp upstream of the start codon of the gene. It is not necessary to include a promoter with the gene when cloning it into pAB or pBA. Instead, a promoter with long sticky ends can be prepared from separate pAB and pBA plasmids just containing promoters. The desired promoter can then be assembled upstream of a gene using the BioBytes method. This abilty to easily 'mix and match' promoters and genes allows gene expresison to be standardized and optimized. Unlikely standard cloning that would requires several days to insert a promoter into a plasmid upstream of a gene, the addition of one DNA segment with the BioBytes method takes only 20minutes. false Team BioBytes annotation2051615 1 XbaI range2051615 1 10 15 annotation2051616 1 -35 range2051616 1 16 21 annotation2051618 1 PstI range2051618 1 47 52 annotation2051617 1 -10 range2051617 1 40 45 BBa_K187005_sequence 1 tgaggaggttctagatttacggctaggtcagtgctaggtactatgcctgcagtg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z