BBa_K187017 1 BBa_K187017 Ampicillin resistance in pAB, Biobytes plasmid 2009-10-16T11:00:00Z 2015-05-08T01:11:07Z The amp resistance gene was cloned out of the plasmid pUC19. Biobytes plasmid pAB is entered as BBa_K187000. Ampicillin resistance can be used as a selectable marker on ampicillin containing plates. This ampicillin resistance gene is present in plasmid pAB (part BBa_K187000), which is one of two universal plasmids for the BioBytes assembly method. For details of the BioBytes method, see its BBF RFC. false true _286_ 0 4048 9 It's complicated false This plasmid includes only the open reading frame (start codon to stop codon) of the amp resistance gene. A promoter and terminator are not included. pAB and pBA do include an RBS consensus sequence positioned 8 bp upstream of the ATG. We recommend that to express amp resistance, you use the Biobytes assembly method together with the promoter and terminator parts we have submited in pAB and pBA to assemble promoters and terminators onto the amp resistance gene. As there is a range of promoters to chose from, this allows rapid manipulation of gene expression level. Using the Biobytes method, several DNA segments can be combined in just 20min per segment. false Team Biobytes BBa_K187017_sequence 1 tgaggaggttctagaatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgcagtg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z