BBa_K1875006 1 BBa_K1875006 A 20 bp target sequence and PAM to make guide operator 8 2016-10-10T11:00:00Z 2016-10-18T11:15:46Z This sequence was synthesized by IDT This guide is expressed by BBa_K1875012 and is the target sequence on BBa_K1875015 false false _2340_ 32290 32298 9 false This sequence was designed based on its orthogonality to the human genome (hg19). false Jeffrey Marano BBa_K1875006_sequence 1 gttgcgcgtccgtatcaaggggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z