BBa_K1882017 1 BBa_K1882017 Apa-Bam-Promotor-K230Rbind-RBS 2016-10-18T11:00:00Z 2016-10-26T02:22:55Z BBa_J23110; BBa_B0032 Lee et al. Genome Res. 2010. 20: 81-89 "Targeted chromosomal deletions in human cells using zinc finger nucleases" x false false _2347_ 26460 26176 9 false x false Milena Krach BBa_K1882017_sequence 1 gggcccatggatcctttacggctagctcagtcctaggtacaatgctagcgcaaatggatgatcacacaggaaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z