BBa_K189058 1 BBa_K189058 Gp13 of Bacteriophage Mu 2009-10-20T11:00:00Z 2015-05-08T01:11:14Z Bacteriophage Mu, Complete genome One CDS of Bacteriophage Mu, Complete genome Product=???gp13??? Note: hypothetical protein;previously called E14 false false _290_ 0 4058 9 Not in stock false none false Teng Li BBa_K189058_sequence 1 atggaaaacaataaaacatcgtattcgtggctggggaaattcaccacggtgaaacaggaatgcccgacctgcggtaatgaatcccctgaatatctgaaagagtgccctcattgtggcgggctgaaatgcaaccactgcgatatgggcgatgacacagcgtgcatgaattgtgaaggtgaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z