BBa_K1895998 1 BBa_K1895998 SmtA metallothionein and LVA tag. 2016-07-20T11:00:00Z 2016-07-21T05:17:31Z Variant of [[BBa_K519010]] with protein degradation tag from Anderson et al. (1998) This is part [[BBa_K519010]], SmtA which is a metallothionein that can bind to heavy metal ions. This variant has an LVA degradation tag before the stop codon which reduces its half-life in the cell. false false _2361_ 29859 29859 9 false [TODO] false Jake Burton BBa_K1895998_sequence 1 atgacctcaacaacgttggtcaaatgcgcttgtgagccctgtctctgcaacgtcgatcccagcaaagcgatcgatcgcaacggtctgtactactgcagcgaagcctgtgccgatggccacaccggtggtagcaaaggctgcggccacaccggctgtaactgccacggcgcagcaaacgacgaaaactacgctcttgttgcttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z