BBa_K1897008 1 BBa_K1897008 LuxR 2016-10-09T11:00:00Z 2016-10-10T11:16:42Z This part was made based on the genome of Vibrio fischeri. This part was made up of promoter BBa_J23119, RBS BBa_B0030, LuxR coding sequence BBa_C0062 and double terminator BBa_B0015. This part allows for the constitutive expression of LuxR protein from the promoter BBa_J23119. The LuxR protein originated from Vibrio fischeri, and is a regulatory protein of the Lux operon. The Lux operon can be transcribed from from te left (operonL) or right (operonR). Transcription of operonR, which consists of LuxICDABE, occurs only in the presence of N-(3-oxo-hexanoyl)-homoserine lactone (AHL), which is an autoinducer produced by LuxI. This also produces light due to the production of LuxCDABE. Transcription of operonL leads to the production of LuxR. In the presence of rising amounts of AHL, LuxR-AHL complexes begin to form, and LuxR undergoes a conformational change that leads to the activation of the Lux operon. This part can be used if you need constitutive production of LuxR to activate production of genes under the control of pLuxR (BBa_R0062). It also consists of an enzyme cut site XbaI after the biobricks prefix and a KpnI site before the biobricks suffix. false false _2363_ 29432 29432 9 false There is also one HA tag available for characterisation of the protein produced via western blot. false Ang Shi Hui annotation2491076 1 BBa_B0030 range2491076 1 36 50 annotation2491075 1 BBa_J23119 range2491075 1 1 35 annotation2491078 1 HA tag range2491078 1 813 839 annotation2491081 1 BBa_B0012 range2491081 1 923 963 annotation2491079 1 Stop Codon range2491079 1 840 842 annotation2491077 1 BBa_C0062 range2491077 1 63 812 annotation2491080 1 rrnBT1 range2491080 1 843 914 BBa_K1897008_sequence 1 ttgacagctagctcagtcctaggtataatgctagcattaaagaggagaaaccggtcgaccggatgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattacccatacgatgttccagattacgcttaacaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatacggggtaccccg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z