BBa_K1905000 1 BBa_K1905000 Riboswitch to detect E5 mRNA from HPV-16 2016-09-12T11:00:00Z 2016-09-13T08:50:52Z It does not come from a genomic sequence, it assembled and engineered in order to fold and unfold in presence or absence of E5 mRNA. DNA coding for a riboswitch to detect E5 mRNA from Human Papillomavirus type 16. This part includes a promoter (BB_R0010) and a RBS (BBa_B0034), the reverse complementary for a section of E5 DNA coding region, and the original sequence with one base changed. When there is presence of E5 mRNA, the riboswitch turns on and it allows the expression of the reporter protein. false false _2371_ 26350 26350 9 false The main design consideration is the proper fold of the mRNA and hybridization with E5 mRNA. false Juan Carlos Rueda Silva BBa_K1905000_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatgttaacctaaacgcagaggctgcaagcacagagaaaagaggagaaaaagcacagagagcagcctctgcgtataggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z