BBa_K1915000 1 BBa_K1915000 LTNF10 2016-10-04T11:00:00Z 2016-10-17T06:38:55Z The sequence for the LTNF peptides were obtained from (G Chavan, S., & D Deobagkar, D. (2014). In Silico Molecular Interaction Analysis of LTNF Peptide-LT10 with Snake Venom Enzymes. Protein and peptide letters, 21(7), 646-656.) The full sequence was synthesized by IDT. LTNF10 (Lethal Toxin Neutralizing Factor) is a 10 residue peptide that has been shown to neutralize toxins from snakes, scorpions, and bacteria. LTNF peptides were first isolated from opossum (Didephis virginiana) serum. This part contains the LTNF10 peptide as well as C-term Myc and 6xHis tags that can be used for purification and then later removed using the HRV (Human Rhinovirus) protease. false false _2382_ 32244 27521 9 false N/A false John Richardson annotation2486066 1 Myc range2486066 1 59 89 annotation2486065 1 HRV protease recognition site range2486065 1 35 58 annotation2486068 1 Stop codon range2486068 1 120 123 annotation2486064 1 LTNF10 range2486064 1 4 34 annotation2486067 1 6x His range2486067 1 104 121 annotation2486063 1 Start codon range2486063 1 1 3 BBa_K1915000_sequence 1 atgctgaaagcgatggatccgaccccgccgctgctggaagtgctgtttcagggcccggaacagaaactgattagcgaagaagatctgaccagcgcggtggatcatcaccatcatcaccattaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z